Быстрый старт состав: 10 средств быстрый старт для двигателя. Какую жидкость купить для запуска авто зимой

Содержание

Быстрый старт для двигателя — что это? Состав, отзывы и видео

В зимнее время часто бывает так, что завести двигатель с первого раза не получается. Мы уже писали на Vodi.su о том, как правильно заводить автомобиль зимой. Также, любой водитель знает, что при включении зажигания и прокручивании стартера большая нагрузка приходится на аккумулятор и сам стартер. Холодный запуск приводит к скорейшему износу двигателя. Кроме того приходится некоторое время прогревать мотор, а это приводит к повышенному расходу горючего и моторного масла.

Очень популярны зимой такие средства, как «Быстрый Старт», благодаря которым завести машину значительно легче. Что же это за средство и как оно работает? Вреден ли «Быстрый Старт» для двигателя вашего автомобиля?

«Быстрый Старт» — что это, как им пользоваться?

Данное средство предназначено для облегчения запуска двигателя при низких температурах (до минус 50-ти градусов), а также в условиях повышенной влажности и при резких перепадах температур. Во влажном климате часто случается такое, что влага оседает на контактах трамблера или на электродах аккумулятора, соответственно не вырабатывается напряжение достаточное для возникновения искры — «Быстрый Старт» поможет и в этом случае.

По своему составу это аэрозоль с содержанием эфирных легковоспламеняющихся веществ — диэфиры и стабилизаторы, пропан, бутан.

Данные вещества, попадая в топливо, обеспечивают его лучшую воспламеняемость и более стабильное горение. Также в его состав входят смазочные добавки, благодаря которым практически исключается трение в момент запуска двигателя.

Пользоваться данным средством довольно просто.

Сначала нужно несколько раз хорошо встряхнуть баллончик. Затем на протяжении 2-3 секунд его содержимое нужно впрыскивать во впускной коллектор, через который воздух поступает в двигатель. Для каждой конкретной модели нужно смотреть инструкцию — воздушный фильтр, непосредственно в карбюратор, во впускной коллектор.

После того, как впрыснули аэрозоль, заводите автомобиль — он должен завестись нормально. Если же с первого раза не получается, операцию можно повторить. Специалисты не советуют впрыскивать его более двух раз, потому что скорее всего у вас проблемы с системой зажигания и нужно проверять свечи и электрооборудование.

В принципе, если у вас двигатель в норме, то «Быстрый Старт» должен подействовать сразу. Ну а если машина всё равно не заводится — нужно искать причину, а их может быть очень много.

Безопасен ли «Быстрый Старт» для двигателя?

На этот счет ответ у нас будет один — главное не «переборщить». Информация к рассуждению — на Западе аэрозолями облегчающими пуск мотора практически не пользуются, и вот почему.

Во-первых, в их состав входят вещества, которые могут привести к преждевременным детонациям. Детонации в двигателе — очень опасное явление, страдают поршневые кольца, могут прогореть клапаны и даже стенки поршней, на гильзах образуются сколы. Если прыснуть очень много аэрозоля, то мотор может попросту рассыпаться — как-никак в его состав входит пропан.

Во-вторых, эфир в составе «Быстрого Старта» приводит к тому, что со стенок цилиндров смывается смазка. Те же смазочные вещества, которые содержатся в аэрозоле, не обеспечивают нормальную смазку стенок цилиндров. То есть получается, что некоторое время, пока не разогреется масло, двигатель будет работать без нормальной смазки, что приводит к перегреву, деформации и повреждениям.

Понятно, что производители, особенно LiquiMoly, постоянно разрабатывают различные формулы, чтобы избавиться от всех этих негативных последствий. Тем не менее, факт на лицо.

Вот что может произойти с гильзой двигателя.

 

Поэтому мы можем порекомендовать лишь одно:

  • не стоит чрезмерно увлекаться подобными средствами, частое использование приводит к быстрому выходу двигателя из строя.

Еще один важный момент — производители дизельных двигатель очень скептически относятся к подобным аэрозолям, особенно если у вас установлены свечи накала.

Дизельный двигатель работает немного по другому принципу и детонация смеси происходит за счет высокого уровня сжатия воздуха, из-за чего он нагревается и в него впрыскивается порция дизеля. Если же залить «Быстрый Старт», то детонация может происходить с опережением, что негативно скажется на ресурсе двигателя.

Эффективным «Быстрый Старт» будет для тех транспортных средств, которые долго стояли без работы. Но и здесь нужно знать меру. Гораздо полезнее использовать средства профилактики, благодаря которым уменьшается сила трения, минимизируется износ деталей, системы очищаются от всего осадка — парафина, серы, металлической стружки и так далее. Не нужно также забывать о замене фильтров, особенно масляных и воздушных, ведь часто оказывается так, что именно из-за засорившихся фильтров загустевшее масло не поступает в двигатель.

Лучшие производители средств «Быстрый Старт»

В России традиционно пользуется спросом продукция Liqui Moly. Обратите внимание на аэрозоль Start Fix. Его можно использовать как для всех типов бензиновых двигателей, так и дизельных. Если у вас дизель, то обязательно придерживайтесь инструкции — отключите свечи накала и нагреваемые фланцы. Дроссельная заслонка должна быть полностью открыта, то есть выжмите педаль газа, средство распылять в зависимости от поры года и температуры от одной до 3 секунд. При необходимости операцию можно повторить.

Из других торговых марок можно посоветовать: Mannol Motor Starter, Gunk, Kerry, FILLinn, Presto, Hi-Gear, Bradex Easy Start, Prestone Starting Fluid, Gold Eagle — HEET. Есть и другие марки, но желательно отдавать предпочтение именно американской или немецкой продукции, поскольку данные средства разрабатываются с учетом всех норм и стандартов.

Они содержат все необходимые вещества:

  • пропан;
  • бутан;
  • ингибиторы коррозии;
  • технический спирт;
  • смазочные материалы.

Внимательно читайте инструкцию — некоторые средства предназначаются для определенных типов двигателя (четырех, двухтактных, исключительно для бензиновых или дизельных).

Применяйте стартовые жидкости только при острой необходимости.

Видео-тест средства для “быстрого старта” двигателя в зимнее время года.

А здесь покажут куда необходимо брызгать средство.

Загрузка…

Средство для запуска двигателя 0.2л LIQUI MOLY Start Fix 1085 — цена, отзывы, характеристики, фото

Средство для запуска двигателя 0.2л LIQUI MOLY Start Fix 1085 — специальный состав для быстрого старта двигателя при отрицательных температурах окружающего воздуха, в условиях сырости, при полуразряженной аккумуляторной батарее, залитых свечах зажигания, после длительного простоя, а также нерегулярной подаче топлива. Данное средство содержит в своем составе эфиры, сжиженный газ и антикоррозионные компоненты. Хорошая воспламеняемость эфира и превосходного влаговытесняющего действия, мотор заводится при очень слабой искре или при малом давлении в цилиндрах (в случае дизельного исполнения двигателя). Представленный состав станет прекрасным помощником при эксплуатации сезонной техники, такой как: мотоциклы, снегоходы, газонокосилки и снегоуборщики. Компоненты в составе данного средства не повреждают клапаны и гарантируют надежную антикоррозионную защиту деталей.

Параметры упакованного товара

Единица товара: Штука
Вес, кг: 0,21

Длина, мм: 53
Ширина, мм: 53
Высота, мм: 158

Преимущества LIQUI MOLY 1085

  • Облегчает запуск двигателя внутреннего сгорания;
  • Применение средства для запуска двигателя 0. 2л LIQUI MOLY Start Fix 1085 эффективно и при экстремально низких температурах;
  • Щадит мотор и аккумулятор;
  • Лёгкий и щадящий запуск двигателя;
  • Смазка и антикоррозионная защита;
  • Предназначен для бензиновых и дизельных двигателей.

Произведено

  • Германия — родина бренда
  • Германия — страна производства*
  • Информация о производителе
* Производитель оставляет за собой право без уведомления дилера менять характеристики, внешний вид, комплектацию товара и место его производства.

Указанная информация не является публичной офертой

На данный момент для этого товара нет расходных материалов

Аэрозоль быстрый старт


аэрозоль «быстрый старт», особенности использования и принцип работы

Как правило, в зимний период у многих автовладельцев появляются определенные трудности, которые связаны с запуском холодного двигателя автомобиля. Другими словами, завести двигатель быстро не получается, после нескольких неудачных попыток разряжается АКБ и т.д.

В подобной ситуации, когда холодный мотор не заводится, на помощь приходят различные средства и способы. Одни водители используют решения для предпускового подогрева ДВС, другие пытаются пополнить заряд АКБ при помощи пуско-зарядных устройств, третьи прибегают к продуктам автохимии. Далее мы поговорим о том, что такое аэрозоль «быстрый старт» и как это работает, а также какие плюсы и минусы имеет подобное решение.

Содержание статьи

Жидкость «быстрый старт» для двигателя автомобиля

Начнем с того, что средства типа «быстрый старт» позволяют легко завести машину. При этом у многих возникают сомнения, вреден ли «быстрый старт» для двигателя автомобиля и какие последствия могут возникнуть после использования таких продуктов. Давайте разбираться.

  • Итак, чтобы понять, что такое «быстрый старт» и как пользоваться данным средством, начнем с общей информации. Указанное средство предназначается для того, чтобы облегчить запуск двигателя в условиях низких и крайне низких температур (до -50 градусов по Цельсию), в случае значительного повышения влажности, если отмечено значительное колебание температур и т.д.

Средство для запуска двигателя «быстрый старт» фактически является аэрозолем, в котором содержатся диэфиры, пропан, бутан, а также определенные стабилизаторы. Такой состав позволяет аэрозолю легко воспламеняться. После попадания в горючее удается добиться легковоспламеняемости и стабильности горения рабочей смеси.

Еще в составе средства присутствуют смазочные компоненты, которые минимизируют сухое трение отдельных элементов в момент запуска ДВС. По заверениям производителей, средство безопасно, отмечена простота использования.

Как пользоваться аэрозолем для запуска двигателя

Перед применением баллон с аэрозолем нужно встряхнуть, после чего  следует впрыснуть состав во впускной коллектор или в карбюратор (в зависимости от типа системы питания двигателя). Делается впрыск из баллона на протяжении короткого отрезка времени (2-3 сек.). поданного за это время количества состава будет вполне достаточно для облегчения пуска.

После впрыска аэрозоля машину можно заводить, при этом ДВС должен легко и быстро запуститься. В том случае, если быстрого пуска не получилось, процедуру следует повторить. Если же мотор не завелся и после второго раза, тогда попытки следует прекратить. Вероятнее всего, проблемы возникли с системой зажигания, свечами, проводами, распределителем зажигания, катушкой и т.д.

Другим словами, двигатель в таком случае не заводится именно по причине поломки или сбоев в работе оборудования, а не в результате похолодания, ухудшения испаряемости топлива при отрицательных температурах и т.д. На практике, исправный мотор после использования аэрозоля «быстрый старт» должен сразу завестись. Если запуск не происходит, холодный двигатель не заводится, тогда это указывает на поломку и нужно сначала обнаружить и устранить причину.
  • Теперь поговорим о возможном вреде для мотора. Сразу отметим, при использовании основной задачей является впрыснуть строго рекомендуемое количество состава. Другими словами, не допускается превышение количества. Это основное правило.

Что касается практической эксплуатации и отзывов, аэрозоли для облегчения запуска двигателя крайне непопулярны в развитых странах, также к решению скептически относятся и опытные отечественные автолюбители.

Хотя производители данных средств говорят о безопасности, с учетом того, что в составе аэрозоля находятся легковоспламеняемые вещества, возникает достаточно высокий риск детонации. Хотя в этом случае детонация кратковременна, при этом данное явление все равно вредно для двигателя.

От детонации разрушаются поршневые кольца, страдают поршни, прогорают клапаны, гильзы цилиндров повреждаются и т.д. Большое количество аэрозоля во впуске может привести к тому, что возникает взрывной «удар», который никак не полезен для мотора и может привести к нежелательным последствиям.

Еще добавим, что эфиры в составе подобных средств  смывают масло со стенок цилиндров. При этом смазочные добавки в самом средстве не способны обеспечить необходимое смазывание. Это значит, что какое-то время после запуска двигатель подвержен сильному износу, что чревато образованием задиров, деформациями и другими повреждениями.

Какой состав для облегчения запуска мотора лучше выбрать

Изготовители аэрозолей данного типа постоянно создают различные уникальные составы, чтобы свести все риски к минимуму и одновременно привлечь покупателя. Хотя выбор подобных решений «быстрый старт» достаточно широкий, следует выделить предложения от Liqui Moly.

Состав предназначен для бензиновых и дизельных двигателей. Кстати, для дизелей перед использованием необходимо отключать свечи накаливания, нагреваемые фланцы и т.д. Дроссельная заслонка должна быть в максимально открытом положении (педаль газа выжата до упора).

Также кроме Liqui Moly следует выделить Mannol Motor Starter, средства для быстрого запуска мотора Hi-Gear и т. д. На рынке есть и другие решения, однако как показывает практика, лучше отдавать предпочтение известным брендам.

Еще перед покупкой нужно обращать внимание на то, для какого ДВС предназначен тот или иной состав. Решения могут быть комбинированными, предполагать использование только в бензиновых или дизельных агрегатах, двухтактных, четырехтактных и т.д.

Советы и рекомендации

Если говорить о практической эксплуатации, использовать аэрозоли и жидкости «быстрый старт» нужно только в случае крайней необходимости. Другими словами, не следует пользоваться такими составами постоянно. Важно понимать, что аэрозоли смывают масляную пленку, а также могут быть причиной детонации двигателя.

Особенно это актуально для дизеля, который работает несколько иначе, чем бензиновые аналоги. Данные агрегаты имеют свечи накаливания, а не свечи зажигания, дизтопливо воспламеняется от сжатия и нагрева, а не от искры на свече зажигания и т.д.

В том случае, если используется аэрозоль для облегчения запуска дизельного двигателя, воспламенение топлива может происходить раньше нормы, что негативно сказывается на моторесурсе дизельного двигателя.

Также добавим, что не следует использовать жидкость для легкого старта по принципу «чем больше, тем лучше». Избыточное количество легковоспламеняемого состава может привести к возникновению ударных нагрузок, в результате значительно возрастает риск серьезной поломки двигателя.

Рекомендуем также прочитать статью о том, как работает промывка двигателя Hi-Gear. Из этой статьи вы узнаете о принципах действия данной промывки, а также о возможных последствиях после использования промывок масляной системы перед заменой моторного масла.

При учете того, что двигатель исправен, такой подход избавит владельца от трудностей и проблем с запуском двигателя даже в тяжелых условиях, при этом нагрузки на стартер и износ в момент холодного пуска будут минимальными.

Читайте также

krutimotor.ru

Аэрозоль для запуска двигателя «Быстрый старт»

«Даже не схватывает, ни одной вспышки!..» Стартер бодро крутит, но двигатель не заводится — знакомая ситуация? Увы, хороший аккумулятор — ещё не гарантия успешного зимнего запуска. Чем ниже температура за бортом, тем больше факторов должно совпасть, чтобы уехать не на автобусе. Помимо очевидных — исправных свечей и подходящего топлива, это и хорошая компрессия в цилиндрах, и корректность работы датчиков двигателя, и правильные пропорции топливно-воздушной смеси.

А что если создать немного смеси заранее, вручную? Легко воспламеняемой и летучей, чтобы точно попала в цилиндры и зажгла там — во всех смыслах. Примерно так и работает автохимия «Быстрый старт», позволяя обмануть блок управления двигателя и все его датчики.

Быстрый старт. Волшебный аэрозоль

Аэрозоль для запуска «Быстрый старт» — это горючая смесь эфиросодержащих жидкостей и газов, воспламеняемость которых заметно выше, чем у бензина. Состав внутри баллона может быть разным: диэтиловый эфир, петролейный эфир, пропан-бутан, гептан. Но принцип работы у всех этих средств одинаковый: создать в цилиндрах первые вспышки и привести поршни в движение, попутно разогрев камеру сгорания и свечи.

Работу «Быстрого старта» можно сравнить с жидкостью для розжига костра: сперва загорается она, выделяя тепло, а следом — дрова и угли. В нашем случае — бензин.

Жидкость «Быстрый старт» дает шанс на успешный запуск в мороз даже изношенному двигателю с плохой компрессией и переливающими топливо форсунками. Но пользоваться ей нужно с умом.

Как пользоваться быстрым стартом

Главное правило работы с «Быстрым стартом» — применять с осторожностью. Не забывайте, что в баллоне под давлением находится весьма огнеопасный состав, который вы собираетесь выпустить наружу. Достать из багажника огнетушитель и поставить рядом на всякий случай — неплохая идея.

Самый частый вопрос у водителей: «Куда брызгать „Быстрый старт“»? Чтобы средство без помех попало в цилиндры, распылять его нужно после воздушного фильтра, приоткрыв и отогнув его короб. Ещё эффективнее снять впускной патрубок и брызгать эфиром прямо в блок дроссельных заслонок.

Не стоить увлекаться: достаточно распылить средство в течение 3–5 секунд. Если двигатель не завелся после первой порции «допинга», можно повторить процедуру ещё раз. Но после двух неудач подряд в дальнейших попытках смысла нет — очевидно, что-то не так с системой зажигания (свечами, бронепроводами или катушками, а может и с бортовой электрикой). Если свечи были сильно залиты бензином — дайте им просохнуть какое-то время, а лучше выкрутите и просушите, или смените на новые. Чудес не бывает — без искры даже «Быстрый старт» не загорится.

Кстати, помощь друга может быть весьма опасной — не пытайтесь заводить двигатель, пока кто-то распыляет «Быстрый старт» во впускной патрубок. Языки пламени могут с громким хлопком вырваться наружу, пройдя сквозь коллектор, и ваш помощник получит ожог руки. Техника безопасности проста: сперва брызгаем, и лишь затем пробуем заводиться.

Быстрый старт для дизеля

На дизелях «быстрый старт» применяют с рядом оговорок. С одной стороны, большинство продающихся средств универсальны. RUNWAY STARTING FLUID, HI-GEAR START-UP, ABRO STARTING FLUID — все они предназначены как для бензиновых, так и для дизельных моторов. С другой стороны, наличие в конструкции дизеля свечей накаливания вносит свои коррективы. Попав на раскаленные свечи, эфир может сдетонировать при обратном движении поршня (в противофазе), что грозит «фаершоу» под капотом и даже повреждением клапанов.

Для безопасного использования «Быстрого старта» в дизеле лучше временно отключить свечи накаливания, вытащив соответствующее реле (Glow plug relay в блоке предохранителей). Или хотя бы активировать стартер максимально быстро, не задерживаясь при включении зажигания, чтобы свечи не успели раскалиться.

Вреден ли быстрый старт

Конечно, подобный взрывной запуск — не самая полезная процедура; двигатель стартует довольно жестко, испытывая повышенные нагрузки. Но если использовать «Быстрый старт» редко и по инструкции, то негативных последствий для техники не будет.

В составе хороших аэрозолей есть смазывающие добавки, чтобы исключить сухое трение в момент запуска и не допустить микрозадиров на стенках цилиндров. Тем не менее, «Быстрый старт» должен оставаться средством на экстренный случай, а не ежедневным ритуалом. Если двигатель заводится в мороз только с «допингом» — не мучайте машину, займитесь поиском причин. Не стоит пользоваться «Быстрым стартом» постоянно, как героиня видео:

Народные методы

В интернете можно найти инструкции по самостоятельному изготовлению «Быстрого старта» из горючих жидкостей и масла. Это классические вредные советы — не пытайтесь сделать средство для запуска двигателя по народным рецептам! Относительную безопасность фирменных аэрозолей обеспечивает летучесть эфиров — они быстро испаряются из впускного тракта, не скапливаясь внутри. А вот самодельный «розжиг» из керосина или ацетона — реальный шанс устроить под капотом пожар и спалить всю машину. Лучше всё-таки на автобусе.

hyperauto.ru

Аэрозоль «Быстрый старт». Инструкция по применению и отзывы автолюбителей.

Проблема запуска из-за сильных морозов — явление довольно распространенное. Русские зимы зачастую преподносят сюрпризы в виде резкого падения температуры до критически низких отметок. Что делать, если срочно нужно выезжать, а двигатель не подает признаков жизни? Одним из общепризнанных вариантов является применение аэрозолей «Быстрый старт». Рассмотрим их подробнее.

Содержание:

  1. Что такое аэрозоли «Быстрый старт»
  2. Аэрозоли «Быстрый старт»: инструкция по применению
  3. Популярные составы для помощи при зимнем запуске

Что такое аэрозоли «Быстрый старт»

Составы с общепринятым названием «Быстрый старт» представляют собой смесь летучих веществ, обладающих высокой способностью к воспламенению. Первые средства создавались на основе природных газов, таких как бутан и пропан, а также различных эфирных смесей. Такой подход не позволял создать безопасное, но в то же время действенное средство.

Современные аэрозоли, предназначенные для помощи запуска двигателя в морозы, имеют сложный химический состав. Действие этих средств за годы эксплуатации было детально изучено, и качественные образцы при соблюдении правил применения стали особенно действенными и абсолютно безопасными. Сейчас аэрозоли «Быстрый старт» состоят из целого комплекса различных нормализующих и смазывающих присадок, которые призваны защитить детали двигателя от сухого трения и избежать детонационных процессов.


Аэрозоли «Быстрый старт»: инструкция по применению

Средства для помощи пуска двигателя в морозы всегда сопровождаются инструкцией. Это обязательное условие, так как неправильное использование аэрозоля может не только привести к повреждениям двигателя, но и стать причиной травм. Если же соблюдать инструкцию, то применение этих средств становится полностью безопасным. Рассмотрим основные правила, которые являются универсальными для всех составов:

  1. Соответствие применяемого аэрозоля типу двигателя. Различают составы для применения на дизельных и бензиновых двигателях, а также универсальные. Стоит помнить, что некоторые производители не рекомендуют применение аэрозолей «Быстрый старт» для турбированных двигателей.
  2. Соблюдение рекомендованной точки ввода средства. Впрыск может осуществляться через воздухозаборник фильтра, во впускной коллектор или непосредственно в карбюратор. Это зависит от состава аэрозоля и типа двигателя. Сегодня все большее количество производителей добавляет в состав своих аэрозолей смазывающие и нормализующие горение присадки. Такие средства недопустимо впрыскивать в систему перед воздушным фильтром: во-первых, это приведет к засорению фильтра; во-вторых, большинство вспомогательных компонентов не попадет в двигатель и, соответственно, не окажет своих защитных свойств.
  3. Строгое соблюдение дозировки. На баллончике аэрозоля всегда указывается время, в течение которого необходимо осуществлять впрыск. Превышение количества вводимого средства может привести к серьезным негативным последствиям вплоть до выхода двигателя из строя.
  4. Подготовка. Перед пуском аэрозоля в систему впуска необходимо несколько раз провернуть коленчатый вал двигателя, даже если вы уверены, что без помощи мотор не запустится. Это позволит привести трущиеся детали двигателя в рабочее состояние. Дело в том, что резкая нагрузка от сгорающего аэрозоля на подмерзший двигатель может вызвать повреждения в парах трения. Для использования на дизельных двигателях рекомендуется предварительно отключить свечи накала и открыть до конца дроссельную заслонку.
  5. Соблюдение условий хранения. Все производители отмечают, что прямое падение солнечных лучей может привести к разгерметизации баллона. Если зимой этот фактор нивелируется низкими температурами, то летом аэрозоль лучше убрать из автомобиля.

И главное: не допускайте попадания аэрозолей на слизистые оболочки и в дыхательные пути. Химический состав этих средств довольно токсичен для человека.

Популярные составы для помощи при зимнем запуске

Кратко рассмотрим несколько распространенных на рынке России составов для быстрого запуска двигателя в порядке увеличения их стоимости:

  1. «Быстрый старт» KERRY — универсальное средство. Подходит для дизельных и бензиновых двигателей вне зависимости от типа питания. Впрыскивается в приемное отверстие воздушного фильтра. Отсутствие комплексных смазывающих присадок делает это средство малопригодным для ежедневного применения в регионах с длительными морозами.
  2. «Быстрый старт» FENOM — ещё один универсальный аэрозоль. Стоит немного дороже предшественника. Выпускается компанией Hi-Gear, известным производителем автохимии. Впрыскивается в воздухозаборник или непосредственно во впускной коллектор. Состоит из ароматических углеводородов и эфиров. Не рекомендуется для ежедневного использования.
  3. «Быстрый старт» StepUp. Относительно дорогое и высокотехнологичное средство. Благодаря добавлению кондиционера металла SMT2 защищает детали цилиндро-поршневой группы от повреждений. Наличие стабилизирующих и активирующих присадок делают процесс горения равномерным и стабильным, что практически исключает возможность детонации. Впрыскивается непосредственно во впускной коллектор. Идеально подходит для ежедневного использования в условиях самых суровых морозов.

Отзывы об аэрозолях «Быстрый старт» в большинстве случаев положительные. Причем имеющаяся незначительная доля негативных мнений складывается в основном из-за непонимания ситуации с зимним запуском в целом. Важно помнить, что данные аэрозоли — не панацея от всех недугов мотора и не восстановительное средство! Составы быстрого старта всего лишь помогают запустить исправный двигатель при критически низких температурах. Если запуск после использования аэрозоля не произошел — скорее всего, имеются серьезные проблемы с двигателем.

Приобрести аэрозоли «Быстрый старт» недорого можно в интернет-магазине TopDetal.ru. Просто позвоните по телефону 8 800 555-67-06 или закажите обратный звонок.

Также в процессе подготовки к зиме не забудьте обновить ленты стеклоочистителей. Как их подобрать — читайте на нашем сайте.


topdetal.ru

Быстрый старт для двигателя — что это? Состав, отзывы и видео

В зимнее время часто бывает так, что завести двигатель с первого раза не получается. Мы уже писали на Vodi.su о том, как правильно заводить автомобиль зимой. Также, любой водитель знает, что при включении зажигания и прокручивании стартера большая нагрузка приходится на аккумулятор и сам стартер. Холодный запуск приводит к скорейшему износу двигателя. Кроме того приходится некоторое время прогревать мотор, а это приводит к повышенному расходу горючего и моторного масла.

Очень популярны зимой такие средства, как «Быстрый Старт», благодаря которым завести машину значительно легче. Что же это за средство и как оно работает? Вреден ли «Быстрый Старт» для двигателя вашего автомобиля?

«Быстрый Старт» — что это, как им пользоваться?

Данное средство предназначено для облегчения запуска двигателя при низких температурах (до минус 50-ти градусов), а также в условиях повышенной влажности и при резких перепадах температур. Во влажном климате часто случается такое, что влага оседает на контактах трамблера или на электродах аккумулятора, соответственно не вырабатывается напряжение достаточное для возникновения искры — «Быстрый Старт» поможет и в этом случае.

По своему составу это аэрозоль с содержанием эфирных легковоспламеняющихся веществ — диэфиры и стабилизаторы, пропан, бутан.

Данные вещества, попадая в топливо, обеспечивают его лучшую воспламеняемость и более стабильное горение. Также в его состав входят смазочные добавки, благодаря которым практически исключается трение в момент запуска двигателя.

Пользоваться данным средством довольно просто.

Сначала нужно несколько раз хорошо встряхнуть баллончик. Затем на протяжении 2-3 секунд его содержимое нужно впрыскивать во впускной коллектор, через который воздух поступает в двигатель. Для каждой конкретной модели нужно смотреть инструкцию — воздушный фильтр, непосредственно в карбюратор, во впускной коллектор.

После того, как впрыснули аэрозоль, заводите автомобиль — он должен завестись нормально. Если же с первого раза не получается, операцию можно повторить. Специалисты не советуют впрыскивать его более двух раз, потому что скорее всего у вас проблемы с системой зажигания и нужно проверять свечи и электрооборудование.

В принципе, если у вас двигатель в норме, то «Быстрый Старт» должен подействовать сразу. Ну а если машина всё равно не заводится — нужно искать причину, а их может быть очень много.

Безопасен ли «Быстрый Старт» для двигателя?

На этот счет ответ у нас будет один — главное не «переборщить». Информация к рассуждению — на Западе аэрозолями облегчающими пуск мотора практически не пользуются, и вот почему.

Во-первых, в их состав входят вещества, которые могут привести к преждевременным детонациям. Детонации в двигателе — очень опасное явление, страдают поршневые кольца, могут прогореть клапаны и даже стенки поршней, на гильзах образуются сколы. Если прыснуть очень много аэрозоля, то мотор может попросту рассыпаться — как-никак в его состав входит пропан.

Во-вторых, эфир в составе «Быстрого Старта» приводит к тому, что со стенок цилиндров смывается смазка. Те же смазочные вещества, которые содержатся в аэрозоле, не обеспечивают нормальную смазку стенок цилиндров. То есть получается, что некоторое время, пока не разогреется масло, двигатель будет работать без нормальной смазки, что приводит к перегреву, деформации и повреждениям.

Понятно, что производители, особенно LiquiMoly, постоянно разрабатывают различные формулы, чтобы избавиться от всех этих негативных последствий. Тем не менее, факт на лицо.

Вот что может произойти с гильзой двигателя.

 

Поэтому мы можем порекомендовать лишь одно:

  • не стоит чрезмерно увлекаться подобными средствами, частое использование приводит к быстрому выходу двигателя из строя.

Еще один важный момент — производители дизельных двигатель очень скептически относятся к подобным аэрозолям, особенно если у вас установлены свечи накала.

Дизельный двигатель работает немного по другому принципу и детонация смеси происходит за счет высокого уровня сжатия воздуха, из-за чего он нагревается и в него впрыскивается порция дизеля. Если же залить «Быстрый Старт», то детонация может происходить с опережением, что негативно скажется на ресурсе двигателя.

Эффективным «Быстрый Старт» будет для тех транспортных средств, которые долго стояли без работы. Но и здесь нужно знать меру. Гораздо полезнее использовать средства профилактики, благодаря которым уменьшается сила трения, минимизируется износ деталей, системы очищаются от всего осадка — парафина, серы, металлической стружки и так далее. Не нужно также забывать о замене фильтров, особенно масляных и воздушных, ведь часто оказывается так, что именно из-за засорившихся фильтров загустевшее масло не поступает в двигатель.

Лучшие производители средств «Быстрый Старт»

В России традиционно пользуется спросом продукция Liqui Moly. Обратите внимание на аэрозоль Start Fix. Его можно использовать как для всех типов бензиновых двигателей, так и дизельных. Если у вас дизель, то обязательно придерживайтесь инструкции — отключите свечи накала и нагреваемые фланцы. Дроссельная заслонка должна быть полностью открыта, то есть выжмите педаль газа, средство распылять в зависимости от поры года и температуры от одной до 3 секунд. При необходимости операцию можно повторить.

Из других торговых марок можно посоветовать: Mannol Motor Starter, Gunk, Kerry, FILLinn, Presto, Hi-Gear, Bradex Easy Start, Prestone Starting Fluid, Gold Eagle — HEET. Есть и другие марки, но желательно отдавать предпочтение именно американской или немецкой продукции, поскольку данные средства разрабатываются с учетом всех норм и стандартов.

Они содержат все необходимые вещества:

  • пропан;
  • бутан;
  • ингибиторы коррозии;
  • технический спирт;
  • смазочные материалы.

Внимательно читайте инструкцию — некоторые средства предназначаются для определенных типов двигателя (четырех, двухтактных, исключительно для бензиновых или дизельных).

Применяйте стартовые жидкости только при острой необходимости.

Видео-тест средства для «быстрого старта» двигателя в зимнее время года.

А здесь покажут куда необходимо брызгать средство.

Загрузка…

vodi.su

Аэрозольный эфир для запуска двигателя

Эфир для запуска двигателя как бензинового, так и дизельного является крайней вспомогательной мерой. При его использовании происходит очень жесткое включение, выраженное в мощных пугающих ударах внутри двигателя.

Как правило, новые рабочие двигатели не требуют дополнительной стимуляции при запуске даже в зимнее время при низких температурах в окружающей среде.

Предназначение баллончиков «Быстрый старт»

При температурах окружающей среды ниже нуля у водителей часто возникают проблемы с запуском двигателя. При холодном запуске наблюдаются следующие негативные моменты:

  • повышенные нагрузки, получаемыестартером и аккумулятором;
  • ускоренный износ внутренних рабочих элементов двигателя;
  • длительный прогрев мотора приводит к повышенному расходу бензина или дизельного топлива, а также смазочных материалов.

В зимний период водители часто используют популярное средство «Быстрый старт», которое эффективно помогает запустить мотор. При помощи данного средства облегчается запуск силового агрегата при максимально низкой температуре, доходящей до отметки минус пятьдесят градусов Цельсия.

Повышенная влажность и резкие перепады температуры также являются помехой для включения моторов.Влажный климат вызывает оседание водяной росы на трамблере и его контактах, электроды аккумулятора также подвержены вредным воздействиям влаги. Вырабатываемого напряжения недостаточно для того, чтобы появилась искра — аэрозольное эфирное средство также призвано помочь в подобных ситуациях.

В состав аэрозоля входят легко воспламеняющиеся эфирные вещества: бутан, пропан, стабилизаторы. При их соединении с топливными массами улучшается воспламеняемость и стабилизируется дальнейшее сгорание.

Смазочные добавки, входящие в состав вещества, существенно уменьшают трение рабочих поверхностей деталей и узлов двигателя во время запуска силового агрегата.

Как пользоваться аэрозольным эфиром

Правила пользования данными средствами довольно просты:

  1. Встряхнуть хорошенько баллончик с эфиром.
  2. В течение двух секунд аэрозоль впрыскивается в трубу впускного коллектора, чтобы некоторое количество содержимого баллончика попало внутрь двигателя вместе с воздухом.
  3. После правильно проведенного впрыскивания мотор заводится без промедления.
  4. При несрабатывании запуска действие повторяется.

Опытные автовладельцы не советуют производить впрыск аэрозоля более, чем два раза. Если мотор не реагирует, необходимо проверить работу следующих систем:

  • Зажигание.
  • Электрооборудование.
  • Свечи.

При удовлетворительном состоянии всех систем и узлов силового агрегата аэрозоль «Быстрый старт» действует незамедлительно. При нежелании мотора заводиться необходимо производить тщательную диагностику каждого элемента двигателя.

Безопасность использования аэрозолей, содержащих эфир

Главное условие безопасности при использовании данного средства — не переусердствовать с количеством впрыскиваний. Западные автолюбители не прибегают к помощи аэрозолей, облегчающих запуск движка, т. к. эти средства обладают отрицательными качествами, вызывающими следующие дефекты силового агрегата:

  1. Наличие в составе средств быстро воспламеняющихся веществ, приводит к частым детонациям.
  2. Деформации поршневых колец.
  3. Прогорание клапанов и стенок поршней.
  4. Образование сколов на гильзах.
  5. Перегрев двигателя.
  6. Повреждения рабочих узлов и деталей.

Коллектив известной корпорации LiquiMoly в постоянном поиске различных химических формул, способствующих избавлению от перечисленных негативных явлений. После проведения многочисленных испытаний, разработчики пришли к выводу: не стоит часто пользоваться данным средством во избежание быстрого выхода из строя автомобильного двигателя.

Конструктивные особенности дизельных двигателей также не позволяют частое использование данных средств, чтобы избежать повторяющихся случаев детонации. Залитый аэрозоль «Быстрый старт» при высоких температурах, образующихся вследствие сильного сжатия воздуха, и при смешивании с дизельным топливом вызывает опережающую детонацию, что резко снижает общий ресурс силового агрегата.

Наилучшую эффективность стимулирующие средства показывают при использовании в машинах после длительного простоя.

В отечественной торговой сети имеются аэрозольные средства «Быстрый старт», содержащие эфир для запуска двигателя, от известных производителей:

  • LiquiMoly;
  • Start Fix;
  • Mannol Motor Starter.

При покупке специалисты советуют выбирать продукцию американских либо немецких производителей, т. к. на предприятиях эти стран учитываются все нормы и стандарты при производстве требуемого средства.

Описание возможных последствийжесткого запуска мотора на эфире

Опытные автолюбители не рекомендуют часто использовать эфирные средства, помогающие экстренно завести двигатель,из-за опасности возникновения следующихнегативных последствий:

  1. Смывание масляной пленки со стенок цилиндров под воздействием эфира, что приводит к увеличению силы трения рабочих поверхностей.
  2. Термический взрыв внутри двигателя, вызванный обратным ударом маховика по стартеру.
  3. Выход из строя воздушного фильтра.
  4. Корпус воздушного фильтра разрывается под воздействием переизбытка эфира.
  5. Передозировка эфира вызывает соскакивание ремня газораспределительного механизма.
  6. Повреждение шатунов мотора.
  7. Поломка коленчатого вала.
  8. Топливная система полностью выходит из строя.
  9. Поломка насоса низкого давления.
  10. Деформации поршней.
  11. Непредсказуемость в работе силового агрегата (в народе этот эффект называется «движок пошел вразнос»).

Совет: При необходимости использования данных вспомогательных средств, аэрозоль аккуратно в малых количествах впрыскивается во вход впускного коллектора вместо воздушного фильтра.Данную операцию следует производить с помощником, включающим стартер.

Для ускоренного запуска дизеля при помощи эфира нужно изолировать работу свечей накаливания во избежание взрыва на этапе противофазы и возникновения открытого огня в районе впускного коллектора.

Каждый день использовать данные средства, даже при больших морозах, не рекомендуется. Чтобы мотор заводился без стимуляторов, лучше найти причину появившихся сбоев и устранить ее.

Вредные свойства эфира, вызывающие поломки в моторе

Аэрозоли для ускоренного старта имеют в своем составе легко воспламеняющееся вещество — эфир. Пары эфира в определенных соотношениях с молекулами кислорода представляют собой взрывоопасную смесь. При отсутствии определенного опыта не рекомендуется производить запуск силового агрегата при помощи аэрозолей «Быстрый старт», содержащих эфир.

Производители данных средств используют добавки в виде пропана, которые способствуют смягчению запуска. Встречаются также растворы, имеющие в своем составе смазочные материалы для более гуманного влияния на элементы двигателя.

При использовании баллончиков дозировка состава производится на глазок, карбюратор или форсунки не отключаются, топливо продолжает поступать в цилиндры. Летучий эфир в смеси с горючим вспыхивает, от взрыва, увеличения количества газов и топлива количество оборотов двигателя резко возрастает. При этом наблюдаются различные сильные шумовые эффекты в виде лязганья и ударов.

К использованию аэрозолей, содержащих эфир, прибегают автовладельцы машин с изношенными силовыми агрегатами, имеющими длительный ресурс. В таких движках все механизмы, узлы и системы находятся в сработанном состоянии. Производить замену отдельных элементов не имеет смысла, а капитальный ремонт — дорогое удовольствие. Поэтому водителям ничего не остается, кроме применения «Быстрого старта» для запуска мотора.

 

avtodvigateli.com

Аэрозоли «Быстрый старт» — спасительная соломинка

Серия препаратов для быстрого запуска двигателя традиционно считается средствами для зимнего использования, подходит для бензиновых и дизельных двигателей внутреннего сгорания всех типов.

Успешный пуск двигателя, даже в теплое время года, зависит от многих факторов — степени износа цилиндро — поршневой группы, качества топлива, состояния аккумуляторной батареи. В зимний период ситуация значительно осложняется, так как для успешного запуска двигателю необходимо компенсировать дополнительные тепловые потери. Легковоспламеняющаяся смесь «Быстрый старт» значительно снижает требуемый температурный порог для воспламенения топливно-воздушной смеси как для дизельных, так и для бензиновых двигателей.

«Быстрый старт» предназначен для облегчения запуска двигателя при низких температурах воздуха, при высокой влажности, при мокрых свечах зажигания, слабом аккумуляторе, низком качестве топлива. Содержит активаторы воспламенения (диэфиры) и стабилизаторы, обеспечивающие равномерное горение топливо — воздушной смеси и плавное нарастание давления. В состав аэрозолей также входят смазывающие добавки, исключающие сухое трение в момент пуска двигателя.

Состав вводят напрямую в карбюратор или впускной коллектор инжекторного автомобиля. При этом снижается нагрузка на систему зажигания, не снижается ресурс аккумуляторной батареи, уменьшается износ стартера и свечей зажигания.

Другой, не редко встречающейся причиной затрудненного пуска двигателя может быть утечка электричества. Это происходит обычно при высокой влажности и резких перепадах температуры. А объясняется все просто: высокое напряжение зажигания «прошивает» через влажные контакты батареи или трамблера. Они тоже нуждаются в защите зимой, для этой цели также можно использовать «Быстрый старт», который легко удаляет влагу с электрических проводов и соединений, а также препятствует ее дальнейшему образованию.

Еще одно назначение «Быстрого старта» — быстрая диагностика системы питания. Это необходимо, если двигатель заглох, работает с перебоями, плохо «тянет». С помощью аэрозолей «Быстрый старт» можно легко определить, виновата ли в этом система питания. Для этого необходимо впрыснуть состав во впускной трубопровод двигателя. Если неработающий двигатель сразу после этого при прокрутке стартером даст вспышку, а у работающего на время исчезнут перебои, то это означает, что система питания неисправна и причину надо искать именно в ней. Возможно, засорился фильтр, вышел из строя бензонасос, залип запорный клапан карбюратора, вышли из строя датчики микропроцессорного устройства и т.д. Если после нескольких попыток впрыскивания средства двигатель никак не отреагировал на это, то причину надо искать в другом: системе зажигания, механизме газораспределения и т.д.

Порядок применения аэрозолей «Быстрый запуск двигателя»:

1. Интенсивно встряхнуть баллон перед использованием.
2. В течение 2-3 секунд впрыскивать состав в воздухозаборник двигателя или карбюратора.
3. Запустить двигатель в обычном порядке.
4. В случае неудачи повторить распыление один или два раза. Если и в этом случае завести двигатель не удается, необходимо проверить систему зажигания.

Бензиновый двигатель следует запускать без использования подсоса со слегка отжатой педалью газа. Дизельный двигатель следует запускать без использования свечей зажигания с полностью выжатой педалью подачи топлива.

Единственное неудобство, сопряженное с применением препаратов данного класса, вызвано тем, что перед распылением препаратов данной группы необходимо на время демонтировать воздушный фильтр.

Быстрый старт

— Эффективен в применении при температуре до минус 60оС.
— Не вызывает разряд аккумуляторной батареи при повторяющемся пуске стартера, благодаря незамедлительному эффекту.
— Обеспечивает смазывание и защиту верхних частей рабочих цилиндров двигателя.

— Не вызывает коррозию и не наносит вреда пластиковым и резиновым элементам системы питания.

Нельзя применять средство в дизельных двигателях с автоматическими свечами разогрева.
Нельзя пытаться использовать стартовую жидкость при попытке завести двигатель, «залитый» топливом.

hyperauto.ru

Что такое Быстрый старт для двигателя и как им пользоваться

Быстрый старт – это жидкость, которая помогает двигателям внутреннего сгорания работать правильно. Она часто используется для пуска автомобилей, двигатель которых работает неправильно, или для запуска старых автомобилей, когда температура опускается ниже нуля. Чтобы использовать быстрый старт, просто распылите жидкость на воздушный фильтр, затем попробуйте завести двигатель. Всегда будьте осторожны, так как быстрый старт чрезвычайно огнеопасен и слишком большое его количество может привести к повреждению вашего двигателя.

Как пользоваться Быстрым стартом двигателя.

Что такое жидкость быстрый старт

Быстрый старт для двигателя представляет собой летучую, легковоспламеняющуюся жидкость, которая используется для облегчения запуска двигателей внутреннего сгорания, особенно в холодную погоду или в двигателях, которые трудно запускать с использованием обычных процедур. Он обычно доступен в аэрозольном баллончике, и его иногда можно использовать для запуска двигателей с непосредственным впрыском эфира или сжигающих искровых двигателей, работающих на спиртовом топливе.

Какой состав выбрать

Жидкость быстрый старт содержит в основном летучие углеводороды, такие как гептан (основной компонент природного бензина) с небольшим содержанием диэтилового эфира и двуокисью углерода (как пропеллент) для дизеля. В некоторых случаях в качестве пропеллента для карбюратора в состав могут входить бутан или пропан. Исторически сложилось, что диэтиловый эфир с небольшим количеством масла, стабилизатора и углеводородного топлива используется для запуска двигателей внутреннего сгорания из-за низкой температуры самовоспламенения 160 C. Диэтиловый эфир отличается от петролейного эфира (дистиллята сырой нефти, состоящего в основном из пентана и других алканов), который также использовался для запуска двигателей.

Как правильно использовать

Найдите свой воздушный фильтр – это устройства на всех автомобилях, которые позволяют двигателю смешивать воздух с топливом, что и делает его сгорание возможным. Воздушный фильтр всегда будет прикреплён к двигателю и расположен под капотом. Но разные производители изготавливают свои транспортные средства по разным технологиям, поэтому воздушный фильтр на разных авто может быть расположен в разных местах. Чтобы определить его местонахождение, обратитесь к руководству пользователя вашего автомобиля.

ВАЖНО! Воздушный фильтр часто выглядит как металлические трубки. Они могут быть покрыты порошковым покрытием или окрашены в тот же цвет, что и автомобиль.

Распылите небольшое количество аэрозоля в воздушный фильтр. Держите баллон пусковой жидкости вертикально. Направьте сопло банки на воздушный фильтр с расстояния примерно 20 сантиметров. Распыляйте жидкость для быстрого старта двигателя примерно две секунды, затем попробуйте его завести. Если двигатель всё ещё не заводится, повторите процедуру распыления быстрого старта в течение 2-х секунд. Чтобы сделать это, вам нужно удалить крышку воздушного фильтра. Если авто не заводится даже после применения быстрого старта, вам следует обратиться к вашему механику. Если двигатель не запускается даже при соответствующем применении пусковой жидкости, проблемой может быть не сам двигатель. Например, может быть неисправно зажигание или какая-то другая система.

Четырёхтактные двигатели

Быстрый старт распыляется на двигатель вблизи воздушного фильтра, в отверстие карбюратора или отверстие свечи зажигания двигателя для быстрого добавления топлива в цилиндр сгорания. Использование пусковой жидкости для ускорения работы двигателя позволяет избежать износа стартера, особенно на редко используемых автомобилях. Другие виды использования включают запуск в холодную погоду, транспортные средства, которые не имеют топлива, и, следовательно, требуют дополнительного времени для восстановления давления, а иногда и с затопленными двигателями. Механики иногда разбрызгивают спрей для диагностики проблем со стартом, определяя, работает ли искра и система зажигания транспортного средства; если искра достаточна, но система подачи топлива отсутствует, двигатель будет работать до тех пор, пока не будут потреблены пары быстрого старта. Чаще всего средство используется с системами впрыска топлива. При использовании пусковой жидкости с дизельными двигателями, которые имеют систему предварительного подогрева, необходимо соблюдать осторожность, так как быстрый старт может загореться, что приведёт к повреждению двигателя.

Двухтактные двигатели

Быстрый старт не рекомендуется для регулярного использования с некоторыми двухтактными двигателями, поскольку сам по себе не обладает смазочными свойствами. Смазка для двухтактных двигателей достигается с использованием масла, которое либо смешивается с топливом, либо автоматически вводится в систему подачи топлива; двигатели, требующие предварительного введения топлива, запускаются исключительно на быстром старте, не получают достаточной подачи смазки на цилиндр (цилиндры). Двигатели, которые долго не запускались, особенно уязвимы; быстрый старт – сильный растворитель, и удаляет остаточное масло, что ещё больше снижает смазку при отсутствии топлива.

Опасности применения аэрозоля быстрый старт

Храните баллончик правильно. Она горюча и легко воспламеняется. Храните и используйте её согласно рекомендациям производителя на упаковке. Например, не используйте быстрый старт на горячем двигателе или не распыляйте её вблизи него. Не используйте чрезмерное количество жидкости. Слишком много вещества может повредить ваш двигатель. Чтобы определить соответствующий исходный объём жидкости для вашего автомобиля, используйте руководство пользователя и указания, прилагаемые к быстрому старту.

ВАЖНО! Как правило, для запуска вашего двигателя должно быть достаточно пара коротких распылений быстрого старта.

Убедитесь, что вы можете использовать быстрый старт с вашим автомобилем. Жидкость не может использоваться со всеми транспортными средствами. Например, если ваше авто оборудовано свечами накаливания или если ваше транспортное средство использует дизельное топливо, использовать пусковую жидкость вы не сможете. Проверьте руководство пользователя вашего авто, чтобы убедиться, что быстрый старт подходит для использования с вашим автомобилем. Быстрый старт также не может использоваться в двухтактных двигателях, например, в газонокосилках. Если быстрый старт не подходит для вашего автомобиля, попробуйте альтернативу, например, чистящее средство для карбюратора. Выберите качественную пусковую жидкость. При выборе обращайте внимание только на проверенные бренды. Хорошая жидкость должна быстро запускать двигатель с минимальным объёмом распыления.

Отрегулируйте дроссель

Если ваш автомобиль оснащён карбюратором (устройство, которое смешивает воздух и топливо), и не заводится, проверьте дроссель. Если ваш дроссель закрыт, когда вы пытаетесь завести автомобиль, откройте его. Если он был открыт, когда вы пытались завести двигатель, закройте его. Регулировка дросселя также должна использоваться в том случае, если ваше авто заводится, но затем глохнет. Если вы не можете найти свой дроссель, обратитесь к руководству пользователя вашего автомобиля.

Проверьте влажность

Если ваше авто сложно завести в дождливые дни, загляните под крышку распределителя. Если внутри крышки распределителя вы увидите влагу, поверните колпачок вверх дном и распылите в него растворитель (или, если у вас жидкость в бутылке, просто вылейте часть растворителя в колпачок). Откройте растворитель, затем вылейте его. Используйте чистую тряпку, чтобы вытереть остатки растворителя перед заменой колпачка.

ВАЖНО! Крышка распределителя – это небольшая крышка, которая защищает распределительную коробку вашего автомобиля.

Проверьте аккумулятор

Если при включении зажигания вы не слышите никаких звуков, то, скорее всего, клеммы к аккумулятору подключены неправильно. Если они выглядят корродированными (покрытыми коррозией), зажмите отвёртку между разъёмом и клеммой. Закрутите отвёртку, чтобы затянуть соединение. Попробуйте завести двигатель. Если он запускается, очистите или замените кабели аккумуляторной батареи.

drivertip.ru

Жидкость «Быстрый старт» для двигателя

Многим автовладельцам знакома проблема плохого запуска двигателя в условиях низких температур. Это касается как бензиновых, так и дизельных двигателей. При низких температурах в жидкостях, которые содержатся в системах автомобиля, могут происходить процессы, связанные с изменением консистенции жидкостей, прежде всего, масла. 

В некоторых подобных случаях на помощь может прийти специальная жидкость “Быстрый старт” для двигателя. Но прежде чем рассказать читателям о том, как она работает, предлагаем выяснить основные причины проблем с запуском двигателя в холодную погоду. Тогда станет ясно, в каких случаях это средство будет эффективным, а в каких – нет.

Причины проблем с запуском двигателя в мороз

Масло при низких температурах становится более вязким, в результате чего затрудняются все процессы при запуске двигателя. Помимо этого вязкое масло перестает нормально передвигаться по магистралям, что приводит к тому, что трущиеся поверхности двигателя не получают необходимую масляную пленку, обеспечивающую нормальное скольжение. И в результате детали работают на износ.

Есть еще один момент, связанный с запуском двигателя при низких температурах – это падение напряжения в аккумуляторе из-за пониженных температур. Это приводит к тому, что стартер двигателя не может раскрутить маховик до нужных оборотов, чтобы произошел запуск мотора.

Помимо этого, увеличившаяся вязкость масла, может привести к тому, что ведущая шестерня стартера может не «дотягиваться» до шестерни маховика. Но это весьма специфический случай и в такой ситуации жидкость под названием «Быстрый старт», мало поможет. Так как она действует в основном в цилиндрах автомобиля, упрощая запуск двигателя в морозную погоду.

Есть еще один момент, который усложняет запуск двигателя в сильный мороз, связанный с появлением на различных контактах конденсата, что приводит к тому, что искра, которая появляется между электродами свечи, недостаточная, чтобы воспламенить стандартную горючую смесь. И тут нужно менять степень воспламенения горючей смеси, делая ее более горючей, даже при недостаточной силе искры. И в этом случае жидкость «Быстрый старт» для двигателя может решить эту проблему.

Что такое жидкость «Быстрый старт»?

Жидкость, которая именуется «Быстрый старт», сделана в виде аэрозоля. В состав этой жидкости входят ингредиенты, которые делают штатную топливную смесь более горючей. В составе «Быстрого старта» есть хорошо воспламеняющиеся эфиры, спирты, присадки против коррозии, бутан, пропан, смазывающие вещества (масла), различные стабилизаторы и т.п.

Как только жидкость попадает в топливо и смешивается с ним, характеристика топлива, в плане его воспламенения, сильно возрастает. А раз топливо легче воспламенить, то и запуск двигателя в условиях пониженных температур произвести проще. По факту, топливная смесь становится более горючей, и хватит даже искры слабой интенсивности, чтобы произошло возгорание, и двигатель начал работать.

Куда добавляется жидкость «Быстрый старт»?

Жидкость впрыскивается во впускной коллектор, через который в двигатель поступает воздух. Но могут быть варианты, когда аэрозоль впрыскивается в карбюратор двигателя.

Пока состав находится в баллоне, она может расслоиться на тяжелые и легкие жидкости. Для того чтобы жидкость стала однородной, рациональнее всего, перед тем как ее впрыскивать, встряхнуть баллончик с аэрозолем. Как только жидкость будет впрыснута, а это 2-3 секунды и не больше, можно сразу заводить двигатель.

В условиях, когда у двигателя нет каких-то существенных проблем, он заведется сразу. Если не заводится сразу, процедуру можно повторить. Но этим процессом нельзя злоупотреблять, так как можно нанести вред двигателю автомобиля.

Опасности применения аэрозоля «Быстрый старт»

Есть определенные опасности, связанные с использованием жидкости, которая помогает запустить двигатель в холодное время. Основная опасность – это то, что топливная смесь, которая образуется после впрыска аэрозоля, имеет слишком большую способность детонировать. Скорость воспламенения этой смеси гораздо выше, чем у штатной горючей смеси. Отсюда возникает проблема сильного динамического удара на поршень. И такой удар может привести к возможной деформации или поломке некоторых деталей двигателя. В частности, могут страдать поршневые кольца, из-за повышенной температуры могут прогореть клапана и т. д.

Помимо этого смесь может воспламениться еще до того момента, когда поршень достигнет верхней точки. Возникает критическое давление, способное довести температуру смеси до вспышки, еще до момента подачи искры. Это связано с наличием в жидкости летучих эфиров, которые воспламеняются самостоятельно при давлении гораздо меньшем, чем давление при использовании штатной топливной смеси.

Есть еще опасность, что те вещества, которые содержатся в аэрозоли, негативно повлияют на масляную пленку, которая есть на трущихся деталях. Активные вещества растворяют и срывают эту пленку, в результате детали начинают двигаться в условиях сухого скольжения, а это в свою очередь приводит к перегреву деталей, и в некоторых случаях могут возникнуть задиры и сколы. Нагревание трущихся деталей может создать опасность термической деформации. И кроме этого перегрев деталей ведет к тому, что масло теряет свою заданную вязкость, начинает стекать с деталей, разрывается пленка из масла и дальше идут процессы, связанные с сухим скольжением.

Для бензиновых и дизельных двигателей

Для двигателей дизельной группы средство «Быстрый старт» для двигателя рационально применять только в самых крайних случаях. А эксперты говорят, что использовать эти жидкости для запуска дизельных двигателей вообще не следует.

И причина этих ограничений вполне понятна – дизельное топливо воспламеняется за счет повышенного давления. А давление воспламенения эфирной смеси гораздо ниже штатного давления, что приведет к тому, что воспламенение произойдет гораздо раньше, чем это нужно. А это ведет к чрезмерным нагрузкам на узлы и детали поршневой группы.

Для бензиновых двигателей одноразовый впрыск аэрозоля не может привести к катастрофическим последствиям. Если жидкость подавать дозировано и не увеличивать дозу, то ничего страшного не может произойти. Но специалисты рекомендуют использовать  аэрозоль «Быстрый старт» только в тех случаях, когда автомобиль длительное время находился без движения в условиях холода. Применять это средство регулярно не стоит.

avtowithyou.ru

Что такое «быстрый старт» для двигателя?

Проблема завода машины при низкотемпературных условиях знакома многим автолюбителям. Она касается как транспорта, работающего на бензине, так и дизельных двигателей. При понижении температуры в некоторых жидкостях происходят нежелательные процессы, затрудняющие работоспособность силового механизма. Но спасение имеется. Этот уникальный продукт, о котором пойдет сегодня речь, обеспечивает «быстрый старт» двигателя. Для полного понятия о его действии требуется разобраться с факторами, которые способствуют их появлению. Только тогда отпадет вопрос о его результативности. Рассмотрим первопричины, ведущие к проблематичному пуску мотора морозной зимой.

Покупка масла с большим коэффициентом вязкости

Смазка замедленно передвигается по частям механизма, именно поэтому трущиеся элементы главной части авто недополучают желаемый объем масла и не образуют на своих поверхностях пленку.

Итогом вышеуказанных недостатков станет максимальный износ и некачественное скольжение комплектующих.

Нестабильность напряжения

Иногда при функционировании авто при пониженных температурных условиях наблюдается падение напряжения, и агрегат не может набрать требуемое количество оборотов. Следствием этого считается проблематичный пуск мотора. Объяснение проблеме найдено: высокая влажность, благоприятствующая беспрепятственному «утеканию» требуемого напряжения. Предлагаемое специальное средство способно обезопасить контакты аккумулятора и с легкостью устранить излишнюю влагу с проводов.

Нарушение работы шестерни — это весьма редкая проблема, и навряд ли аэрозоль поможет в решении проблемного вопроса.

Наличие конденсата на контактах

Применение товара препятствует появлению конденсата на поверхностных частях деталей. Для устранения проблемы придется сменить степень воспламенения горючего вещества, делая его ещё интенсивнее. На помощь придет «быстрый старт» для двигателя.

Неэффективная деятельность силового механизма

Приведенное изделие за минимальное время проведет диагностирование, определит роль системы питания в поломке путем вспрыскивания жидкости на входной трубопровод двигателя. Если оборудование неработающее, при прокрутке мотора появится вспышка, при работающем перебои мгновенно исчезнут. Возможно, секрет кроется в фильтрах, которые оказались засоренными. Не стоит игнорировать бензонасос и датчики микропроцессорного устройства.

Из строя способна выйти любая деталь. При использовании средства помните, что нескольких вспрыскиваний достаточно для определения первопричины поломки. Если результаты не оправдали себя – ищите причину в другом.

Что представляет собой эта жидкость?

«Быстрый старт» для двигателя — это жидкость, позволяющая успешно запустить силовой агрегат в любых неблагоприятных условиях.

Легковоспламеняющаяся смесь благоприятствует снижению температурного порога, необходимого для разжигания топливно-воздушной смеси.

Основное предназначение товара:

· облегчение работы движка при минусовых температурах;

· предоставление возможности функционирования при повышенной влаге и мокрых свечах зажигания;

· содействует повышению эффективности двигателя при слабой батарее и низком качестве горючего.

Химсостав продукта:

— активные воспламеняющие вещества;

— стабилизаторы;

— антикоррозийные присадки;

— добавки, обладающие смазывающими свойствами, которые исключают возможность сухого трения.

Суть действия продукта

Как говорилось ранее, «быстрый старт» для двигателя – спрей для беспроблемного запуска мотора. Принцип действия заключается во впрыскивании его в горючее с целью смешивания. При этом качественные характеристики топлива начинают возрастать во много раз, что способствует улучшению воспламенения. В итоге топливо легко поддается возгоранию, и его может зажечь даже малейшая искорка. Двигатель запустится без проблем.

Куда наливать вещество?

Согласно инструкции, его распыляют во впускной коллектор, откуда он вместе с воздухом поступит в силовой агрегат.

Но существуют и другие варианты. Некоторые автовладельцы предпочитают добавлять его в карбюратор. Перед распылением жидкости нужно хорошенько встряхнуть баллончик для приобретения им однородной структуры, поскольку в спокойном положении он имеет свойство расслаиваться на тяжелые и легкие субстанции. Встряска должна быть кратковременной, после чего жидкость полностью готова к использованию.

Если движок находится в работоспособном состоянии, тогда при разбрызгивании указанного элемента он заведется обязательно. Если результат обратный – процедуру рекомендовано повторить. Злоупотреблять ею не следует, поскольку выполняемые действия могут нанести непоправимый вред транспортному средству.

Как же работает «быстрый старт» для двигателя? Инструкция пошагового пользования спреем:

1. Интенсивное встряхивание баллона в течение 2 секунд.

2. Двухсекундное впрыскивание смеси в положенный отсек.

3. Пуск механизма в обычном режиме.

4. Повторное распыление элемента (в случае неудачной попытки).

5. Проверка системы зажигания.

При запуске мотора автомобиля следует учесть, что его работоспособность проверяется с немного отжатой педалью газа. «Быстрый старт» для дизельного двигателя требуется выполнять с полноценно отжатой педалью подачи горючего.

Будьте внимательны

При пользовании препаратом нужно проводить демонтаж воздушного фильтра. Также при применении продукта имеются опасности, о которых поговорим ниже.

Детонирующее качество топливной смеси

Образуется моментально, после вспрыскивания аэрозоля.

Объясняется высокой скоростью воспламенения, что усиливает вероятность сильнейшего динамического удара на поршень. Результатом эксперимента может стать повреждение поршневых колец и прогорание клапана. Некоторые случаи предусматривают разжигание топлива ранее положенного, что приводит к созданию критического давления и образованию вспышки еще до появления искры.

Причина проблемы: наличие в химическом составе средства эфирного масла, особенностью которого является способность воспламенения при низком давлении. Негативное влияние активных элементов на детали, поддающиеся трению. Неконтролируемое количество активных веществ влечет за собой растворение и снятие пленки с трущихся комплектующих силового движка, что вызывает образование сухости и приводит к их перегреву. Статистика показывает увеличение на частях оборудования задиров и сколов. В итоге перегрева происходит потеря маслом нужной степени вязкости, которая перестает задерживаться на деталях. Данные процессы приводят к изменению коэффициента изнашиваемости оборудования до максимума, ухудшению работоспособности мотора.

А как обстоят дела с транспортом дизельной группы?

«Быстрый старт» для двигателя (дизель) лучше использовать в экстремальных ситуациях. Профессионалы автодела утверждают в один голос, что это категорически запрещено делать.

Чем это объясняется?

Разжигание дизтоплива может произойти намного раньше положенного, что приведет к чрезмерным нагрузкам на узлы машины и поршневые запчасти. «Быстрый старт» для бензинового двигателя не страшен, но увеличивать дозировку опасно.

Профессионалы предлагают использовать аэрозоль только при длительном нахождении авто в плохих погодных условиях. Регулярно применять «быстрый старт» для бензинового двигателя не рекомендовано. Это существенно сокращает его ресурс. Для инжекторных машин также вызывает сомнение рациональность применения такого средства, как «быстрый старт» для двигателя (инжектор в данном случае не исключение).С ним есть определенные трудности, поскольку мотор начинает тяжело заводиться. Причиной всему считается малое количество во входном тракте паров бензина.

Преимущества аэрозоля:

· эффективен при негативных факторах;

· не влечет за собой разрядку аккумуляторной батареи;

· тщательно смазывает все комплектующие, подверженные трению;

· предотвращает риск возникновения коррозии и оказывает благоприятное воздействие на пластиковые и резиновые элементы питания.

Осторожность необходима при:

— использовании в автотранспорте дизельной группы с автоматическими свечами разогрева;

— применении стартового элемента при попытке завести движок, заправленный горючим материалом.

Итак, мы выяснили все свойства средства «быстрый старт» для двигателя, состав его и правила применения.

fb.ru

что это, куда добавлять, как действует

Автохимия — это активно развивающийся сегмент бизнеса. Регулярно компании выпускают на рынок новые разработки, направленные на улучшение качеств автомобилей. Одним из средств, которое в последнее время все больше набирает популярность, является жидкость “Быстрый старт”. Она предназначена, в первую очередь, для владельцев автомобилей, которые испытывают трудности при запуске двигателя зимой, когда температура окружающей среды сильно ниже нуля. При низких температурах многие жидкости в автомобили, в том числе и масло, меняют свою консистенцию, из-за чего могут возникать всевозможные проблемы. Чтобы “разогреть” масло можно использовать средство “Быстрый старт”, но есть свои нюансы, про которые перед этим нужно знать.


Оглавление: 
 1. Жидкость “Быстрый старт”: что это?
 2. Куда добавлять жидкость “Быстрый старт”
 3. Зачем добавлять “Жидкий старт” 
 4. Можно ли применять “Быстрый старт” с дизельным двигателем?
 5. Негативное воздействие “Быстрого старта” на двигатель
 

Жидкость “Быстрый старт”: что это?

Жидкость “Быстрый старт” (она же может называться “Быстрый запуск”) — это средство в виде аэрозоля, которое строится на базе компонентов, способных сделать топливо более горючим. В зависимости от производителя, состав жидкости “Быстрый старт” может отличаться. Но в нее всегда входит определенный набор составляющих: легковоспламеняющиеся эфиры, спирты, бутан, пропан, смазывающие компоненты, стабилизаторы, антикоррозийные присадки и прочее.

Куда добавлять жидкость “Быстрый старт”

Добавляется состав “Быстрый старт” во впускной коллектор. В зависимости от состава жидкости и производителя, инструкция по использованию жидкости может отличаться, поэтому важно с нею ознакомиться — она нанесена на баллон с составом. Обобщая, можно сказать, что при использовании жидкости “Быстрый старт” нужно выполнить следующую последовательность действий:

  1. Встряхнуть баллон с жидкостью “Быстрый старт” на протяжении 10-15 секунд. Это необходимо, поскольку внутри баллона состав расслаивается на тяжелые и легкие жидкости. Важно привести жидкость в однородную консистенцию;
  2. Далее жидкость впрыскивается во впускной коллектор. При этом продолжительность впрыска должна быть не дольше 2-3 секунд;
  3. После этого сразу можно заводить двигатель — он должен стартовать без проблем.

Важно: В случае, если с первого раза “Быстрый старт” не помог запустить двигатель, можно попробовать во второй раз использовать состав. Если и со второй попытки присадка не возымела желаемый эффект, вероятнее всего, имеются существенные проблемы с зажиганием — нужно провести диагностику системы пуска, свечей зажигания и электрооборудования.

Зачем добавлять “Жидкий старт”

Как было отмечено в начале статьи, состав “Жидкий старт”, в первую очередь, нужен, чтобы устранить сложности при пуске в холодное время года, которые обусловлены:

  • Высокой вязкостью масла. При низкой температуре окружающей среды масло становится более вязким, в связи с чем становится труднее производить пуск двигателя. Вязкое масло медленнее движется по магистралям, из-за чего трущиеся детали недостаточно смазываются и не имеют нормального скольжения, то есть работают с повышенным износом;
  • Низким напряжением в аккумуляторе. Из-за недостаточного напряжения возникают трудности с пуском мотора, поскольку стартер не может раскрутить маховик до требуемых оборотов;
  • Конденсатом на контактах. Из-за образования при низкой температуре конденсата на различных контактах возникают сложности в образовании искры между электродами свечи.

Именно с проблемой недостаточного образования искры между электродами свечи для воспламенения горючей смеси справляется жидкость “Быстрый старт”. Она делает смесь более горючей, тем самым ее воспламенение возникает даже при искрении недостаточной силы.

Можно ли применять “Быстрый старт” с дизельным двигателем?

Вопрос, который интересует владельцев автомобилей с дизельными двигателями, подойдет ли для них жидкость быстрый старт. Не все производители подобных составов указывают в инструкции возможность применения жидкости на дизеле. Связано это с тем, что дизельное топливо воспламеняется из-за высокого давления. А жидкость “Быстрый старт” состоит из эфиров, которые имеют давление воспламенения значительно ниже, чем дизельное топливо. Соответственно, если залить данную жидкость, то воспламенение случится намного раньше, чем предусмотрено конструкцией двигателя, что может навредить состоянию поршневой группы и другим узлам мотора.

Негативное воздействие “Быстрого старта” на двигатель

Провоцируя воспламенение, имеется большая вероятность серьезно навредить автомобильному двигателю. Средство “Быстрый старт” имеет большую способность детонировать, соответственно, при раннем воспламенении данной смеси идет серьезный динамический удар на элементы двигателя, особенно на поршень. В зависимости от качества компонентов двигателя, последствия такого удара могут быть разными.

Можно назвать несколько проблем, к которым может привести регулярное использование жидкости “Быстрый старт”:

  • Вероятность искривления поршня в результате удара;
  • Деформация, повреждение или разрыв поршневых колец;
  • Прогорание клапанов из-за высоких температур;
  • Снижение эффективности работы масла из-за возможного “конфликта” химических элементов в составе смазочного компонента и жидкости “Быстрый старт”;
  • Потенциальный перегрев двигателя и термическая деформация деталей.

Специалисты рекомендуют не использовать жидкость “Быстрый старт” на регулярной основе. Ее лучше применять в экстренных ситуациях, когда пуск двигателя осложнен из-за низких температур или в результате долгого простоя автомобиля.

Загрузка…

okeydrive.ru

Набор «Быстрый старт» для бензиновых и дизельных двигателей. Аэрозоль Kerry.

Каталог товаров

Фильтр товаров


Загрузка …

Сортировать по Цена, по возрастаниюЦена, по убываниюЁмкость: от наименьшейЁмкость: от наибольшойПо названию товара, от А до ЯПо названию товара, от Я до АПо наличию

‘; //]]> ‘; //]]>

Средство «Быстрый старт» в нашем каталоге представлено маркой Kerry.
Данное средство представлено в виде аэрозоли и позволяет запускать двигатели внутреннего сгорания при пониженных температурах, при слабом заряде АКБ или засоренных свечах зажигания.
Набор быстрый старт.

Состав аэрозоли «Быстрый старт» может отличаться в зависимости от производителя. Но основные компоненты, без которых средство просто бы не работало, входят в состав всегда: спирт, пропан, бутан, воспламеняющиеся эфиры, стабилизаторы, смазывающие компоненты и антикоррозийные присадки.

Меры предосторожности:
Использовать быстрый старт для бензинового двигателя нужно в соответствии с мерами предосторожности, соблюдением инструкции. Из-за избытка жидкости во впускном тракте может произойти обратная вспышка с воспламенением состава в коллекторе. С увеличением объема влитой жидкости будет повышаться степень разрушительного воздействия.
Не подходит быстрый старт для дизельных двигателей, имеющих свечи накаливания из-за высокой опасности появления обратной вспышки. Поэтому при применении жидкости свечи нужно выключать.
Если у вас остались вопросы, или вы хотите купить «Быстрый старт» свяжитесь с консультантами наших магазинов, или оформите заказ на сайте.

RUSEFF БЫСТРЫЙ ЗАПУСК 0.25л 19272N

Жидкость для быстрого старта помогает в сильный мороз, при высокой влажности, при плохом качестве топлива, а также при низком заряде аккумуляторной батареи быстро и экономично запускать бензиновые и дизельные двигатели. Оно подходит для запуска легковых и грузовых автомобилей, автобусов, тракторов, строительной техники. Средство снижает износ стартера двигателя и свечей зажигания, уменьшает нагрузку на систему зажигания и аккумуляторную батарею. Рекомендуется для техники, находившейся на консервации или в длительном простое. Еще средство отлично подойдет для запуска снегоходов, бензопил и газонокосилок.

Применение:

Внимание! Не применять на работающем  двигателе.

Во избежание обратного выхлопа не используйте продукт при снятом воздушном фильтре.

Прежде чем использовать один из методов быстрого старта двигателя, нужно точно знать, что в нем масло не застывшее, а топливо (если это дизель) не замерзшее, иначе можно навредить.

 

  • ·  Перед использованием хорошо встряхнуть баллон.
  • ·  Для запуска бензиновых двигателей распылить продукт в течение 2-3 секунд в воздушный фильтр или во впускной коллектор и запустить двигатель.
  • ·  Для запуска дизельных двигателей отключить свечи накаливания и нагреваемые фланцы, открыть дроссельную заслонку, распылить продукт в течение 2-3 секунд во впускной коллектор и запустить двигатель.
  • ·  В случае неудачи повторить распыление один или два раза с перерывом 2-3 минуты.
  • ·  Для диагностики системы питания распылите состав во впускной коллектор.

 

ВНИМАНИЕ! Если сразу после этого при прокрутке стартером неработающий двигатель даст «вспышки» и, после старта, работающий двигатель несколько секунд работает ровно — без перебоев, значит, неисправна система питания: засорился фильтр, трубопровод, инжектор, игольчатый клапан карбюратора, вышел из строя бензонасос и т.д.

 

Если после нескольких попыток впрыскивания нет никакой реакции, то причину надо искать в системе зажигания, механизме газораспределения; других узлах и агрегатах двигателя.

Быстрый старт Runway STARTING FLUID

Быстрый старт Runway STARTING FLUID – специальный аэрозольный состав с высоким содержанием эфира для запуска двигателя в холодное время года. 
Состав содержит специальные смазочные компоненты для верхней части цилиндров, предотвращающие микрозадиры при пуске двигателя в холодное время. 
Предотвращает износ стартера и свечей зажигания, уменьшает нагрузку на аккумулятор и двигатель во время пуска. 
Предназначен для любых бензиновых и дизельных двигателей.

Применение.
Бензиновый двигатель следует запускать не закрывая дроссельную заслонку со слегка отжатой педалью газа. Дизельный двигатель следует запускать без использования свечей накаливания с полностью выжатой педалью подачи топлива.

  1. Хорошо встряхните баллон перед использованием. 
  2. Распыляйте состав в район воздухозаборника или карбюратора в течении нескольких секунд. 
  3. После чего запустите двигатель.
Объём: 400 мл

О производителе.

Тоговая марка RUNWAY принадлежит компании Doctor Chemical Corporation (США), которая входит в число крупнейших химических концернов Соединённых Штатов Америки.
Появившись в начале 2000-х, товары под брендом RUNWAY быстро завоевали симпатии покупателей в России, Украине, Белоруссии, Казахстане и Прибалтике.
На сегодняшний день под торговой маркой RUNWAY выпускается разнообразный ассортимент высококачественных товаров для автомобилистов: полироли, шампуни, средства по уходу за салоном и кузовом, различные герметики, добавки в масло, специализированные очистители двигателя и топливной системы, освежители воздуха, аксессуары и многое другое.
Товары под торговой маркой RUNWAY, реализуемые на территории Украины, производятся преимущественно в КНР и Российской Федерации из сырья и под контролем компании Doctor Chemical Corporation (США).
Сочетание качества высокотехнологичного американского сырья и доступность цены — одно из главных преимуществ продукции торговой марки RUNWAY, которая занимает достойное место среди лидеров по производству автохимии и автокосметики.

Быстрый старт для бензиновых и дизельных двигателей

Запускаем двигатель без проблем в зимнее время!

В зимнее время попытка завести двигатель порой превращается в весьма затруднительный процесс. 

Холодный запуск приводит к быстрому износу мотора, а прогрев ДВС — к быстрому расходу топлива и масла.

Именно поэтому зимой очень популярно такое средство, как «Быстрый Старт», облегчающее запуск ДВС при пониженных температурах и влажном климате. Одна из его функций – помощь в создании достаточного для возникновения искры напряжения в случае, если влага осела на контактах.

Состав

Это аэрозоль, содержащий эфирные вещества с легкой воспламеняемостью (стабилизаторы и диэфиры, бутан, пропан). Такие вещества гарантируют лучшую воспламеняемость и стабильное горение топлива. Также в состав “Быстрого старта” входят смазочные добавки.

Применение

Средство «Быстрый старт» очень просто в использовании. Хорошенько встряхните баллончик, после чего в течение 2-3 секунд вспрыскивайте его содержимое во впускной коллектор. После этого заведите двигатель. Он должен завестись без проблем, если же не получается с первого раза, можно повторить операцию.

Не рекомендуется впрыскивать «Быстрый старт» более двух раз!

Если ваш  двигатель в порядке, то «Быстрый Старт» должен незамедлительно подействовать.

 

Особенности применения к дизельному двигателю

Важным моментом является то, что производители дизельных моторов крайне скептически относятся к данным веществам, особенно при наличии свечей накала. Детонация смеси в диздвигателе происходит из-за высокого уровня сжатия воздуха, благодаря чему он нагревается и происходит впрыск порции дизеля. Из-за применения «Быстрого Старта» детонация может произойти с опережением, что пагубно скажется на ресурсе двигателя.

Если у вашего автомобиля дизельный двигатель, то строго следуйте инструкции:

для начала следует отключить нагреваемые фланцы и свечи накала.

Полностью выжмите педаль газа для открытия дроссельной заслонки. Средство распыляйте в зависимости от температуры и времени года (1-3 сек). Если надо, повторите процедуру.

 

Эффективность

«Быстрый Старт» будет эффективным для транспорта после долгого застоя. Но и здесь нужно знать меру. Лучшим решением будет использование средств профилактики, благодаря которым минимизируется износ деталей, уменьшается сила трения, системы очищаются от осадков серы, металлической стружки, парафина и т.д. Нельзя забывать и о замене фильтров, особенно воздушных и масляных, ведь в большинстве случаев из-за засорившихся фильтров масло перестает поступать в ДВС.

Безопасность

“Быстрый старт” безопасен для двигателя, но лишь при умеренном использовании. На Западе, к примеру, аэрозолями, которые облегчают запуск ДВС, почти не пользуются, и вот почему:

Во-первых, в их состав входят вещества, приводящие к преждевременной детонации. Детонации в двигателе — крайне опасное явление, т.к. могут прогореть клапаны и даже стенки поршней, пострадают поршневые кольца, образуются сколы на гильзах. Если впрыснуть слишком много смеси, то двигатель может попросту рассыпаться.

Во-вторых, эфир, находящийся в составе «Быстрого Старта», приводит к смыву смазки со стенок цилиндров. А смазочные вещества, содержащиеся в аэрозоле, не обеспечивают нормальной смазки стенок цилиндров. Из этого следует, что какое-то время (до разогрева масла) двигатель будет работать без качественной смазки, а это приведет к деформации, перегреву и повреждениям. Конечно, разрабатываются различные формулы, чтобы избавиться от всех негативных эффектов. Однако, факт очевиден. Поэтому нельзя сильно увлекаться такими средствами, ведь их частое использование приводит к скорому выходу ДВС из строя.

Производители

В России по традиции пользуется большим спросом торговая марка Liqui Moly. Также стоит обратить внимание на Start Fix, который можно использовать и для всех типов бензиновых и дизельных двигателей.

Из других марок можно выделить: Gunk, Mannol Motor Starter, FILLinn, Presto, Kerry, Hi-Gear, Prestone Starting Fluid, Gold Eagle — HEET, Bradex Easy Start. Есть и другие, но рекомендуется отдавать предпочтение именно немецкой и американской продукции, поскольку их средства разрабатываются с учетом всех стандартов и в них содержаться все необходимые вещества.

Внимательно читайте инструкцию — некоторые средства предназначаются для определенных типов двигателя (двух-, четырехтактных, только для дизельных или только для бензиновых ДВС).

Применяйте стартовые жидкости только в случае крайней необходимости!

2021 Стартовый состав New York Knicks сегодня

Прогнозируемый стартовый состав

PG: Деннис Смит-младший

Смит-младший пробился в «Никс» в середине прошлого сезона. В целом за год он набирал в среднем 13,6 очка за игру при 2,9 подбора и 4,8 передачи. На драфте 2017 года он был 9-м общим выбором, так что ему уже исполнился 21 год. У него определенно есть куда расти, но в том, что мы видели в прошлом году, он, скорее всего, не собирается ничего делать или ломать с точки зрения Продукция Knicks.Он в значительной степени именно то, что вы ожидаете от PG в команде большого рынка с (очень) проигрышным послужным списком.

SG: RJ Barrett

Несомненно, самая захватывающая вещь в стартовом составе Knicks — , фанаты по всей стране будут настраиваться на игры Knicks, чтобы увидеть этого молодого жеребца из Duke. Он набирал в среднем 22,6 очка за игру с 4,3 активами и в прошлом году у «Синих дьяволов» показатель FG% 30,8. Хотя технически он числился нападающим в Duke, он прекрасно справится с ролью атакующего защитника на уровне НБА.Его рост 6 футов 7 дюймов и вес 202 фунта, так что он будет более чем в состоянии удержаться на этой позиции. На данный момент он опубликовал несколько дабл-дабл в играх Летней лиги НБА.

SF: Кевин Нокс
У

Нокса, 9-го общего драфта Никс в 2018 году, был очень плохой сезон в прошлом году. Конечно, он набирал в среднем 12,8 очка за игру, но также набирал только 4,5 подбора за игру. Его FG% довольно низок — 37,0, но хорошая новость заключается в том, что его 3P% не сильно отстает — 34,3. На него интересно смотреть? Не совсем, но в целом «Никс» не очень интересная команда.Одним из самых ярких моментов этого лета стал клип, в котором Зайон вырвал мяч из рук и тут же взлетел, чтобы нанести огромный удар. Довольно поэтично, если подумать (за счет фанатов «Никс» и их ожиданий в межсезонье).

PF: Юлиус Рэндл

Randle — еще один маяк надежды в составе Knicks в этом году. Сыграв четыре сезона за «Лейкерс», чтобы начать свою карьеру, а затем один за «Пеликанс» в прошлом году, он окажется в форме «Никс», чтобы открыться в этом году.В прошлом году он набирал в среднем 21,4 очка за игру и 8,7 подбора. Его PER 21,02 поставил его на 51-е место во всей лиге.

C: Митчелл Робинсон

Для выбора во втором раунде 2018 года PER Митчелла Робинсона 22,01 в прошлом сезоне стал приятным сюрпризом для «Никс». Это, как ни странно, поставило его на 34-е место в НБА. В прошлом году он набирал в среднем 6,4 подбора за игру, и это нормально, но увеличение этого числа хотя бы на один в этом сезоне очень поможет «Никс».То, что он и Рэндл на посту, будет интересным дуэтом, на который стоит обратить внимание в этом сезоне.

Краткое руководство | Документация по Kubernetes Engine | Google Cloud

Требования к квоте

Для выполнения этого краткого руководства вам потребуется доступная квота на:

  • 1 ЦП Compute Engine в регионе кластера.
  • 1 Используемый IP-адрес.

Чтобы проверить доступную квоту, используйте Облачная консоль.

Выбор снаряда

Для завершения этого краткого руководства вы можете использовать либо Cloud Shell или ваша местная оболочка.

Cloud Shell — это среда оболочки для управления размещенными ресурсами в Google Cloud. Cloud Shell поставляется с предустановленной gcloud инструмент командной строки и Инструмент командной строки kubectl. Инструмент gcloud обеспечивает основной интерфейс командной строки для Google Cloud и kubectl обеспечивает первичный интерфейс командной строки для запуска команд против Кластеры Kubernetes.

Если вы предпочитаете использовать локальную оболочку, необходимо установить инструмент gcloud и инструмент kubectl в вашей среде.

Cloud Shell

Чтобы запустить Cloud Shell, выполните следующие действия:

  1. Перейдите в Google Cloud Console.

    Google Cloud Console

  2. В правом верхнем углу консоли нажмите Активировать Кнопка Cloud Shell :

Сеанс Cloud Shell открывается в кадре ниже на консоли. Вы используете эту оболочку для выполнения команд gcloud и kubectl .

Локальная оболочка

Чтобы установить gcloud и kubectl , выполните следующие действия:

  1. Установите Cloud SDK, который включает инструмент командной строки gcloud .
  2. После установки Cloud SDK установите командную строку kubectl инструмент, выполнив следующую команду:

     компоненты gcloud установить kubectl 

Настройка параметров по умолчанию для инструмента

gcloud

Используйте инструмент gcloud для настройки двух значений по умолчанию. настройки: по умолчанию проект и вычислительная зона.

У вашего проекта есть ID проекта, который является его уникальным идентификатором. Когда вы впервые создаете проект, вы можете использовать автоматически сгенерированный идентификатор проекта или вы можете создать свой собственный.

Ваш вычислительная зона это место в регионе, где ваши кластеры и их ресурсы живут. Например, us-west1-a — это зона в us-west . область, край.

Настройка этих параметров по умолчанию упрощает выполнение команд gcloud , поскольку gcloud требует, чтобы вы указали проект и зону вычислений, в которой ты хочешь работать. Вы также можете указать эти настройки или изменить настройки по умолчанию. настройки с флагами, например --project , --zone и --cluster , в ваших командах gcloud .

При создании ресурсов GKE после настройки по умолчанию проект и вычислительная зона, ресурсы автоматически создаются в этой проект и зона.

Примечание: Инструмент gcloud может вернуть ошибку, если эти настройки либо не настроен, либо не указан.

Установка проекта по умолчанию

Выполните следующую команду, заменив идентификатор проекта на ID вашего проекта:

gcloud config установить проект  идентификатор проекта  

Установка вычислительной зоны или региона по умолчанию

В зависимости от режима работы, который вы выберете для использования в GKE, затем вы указываете зону или регион по умолчанию.Если вы используете Стандартный режим, ваш кластер будет зональным (для этого учебник), поэтому установите зону вычислений по умолчанию. Если вы используете режим автопилота, ваш кластер будет региональным, поэтому установите расчетный регион по умолчанию.

Standard

Выполните следующую команду, заменив compute-zone на ваша вычислительная зона, например us-west1-a :

  gcloud config set compute / zone  compute-zone 
  

Автопилот

Выполните следующую команду, заменив compute-region на ваш вычислительный регион, например us-west1 :

  gcloud config set compute / region  compute-region 
  

Создание кластера GKE

А кластер состоит как минимум из одной плоскости управления кластером машины и нескольких Рабочие машины назвали узлами .Узлы Экземпляры виртуальной машины (ВМ) Compute Engine которые запускают процессы Kubernetes, необходимые для создания они часть кластера. Вы развертываете приложения в кластерах, а приложения запускаются на узлах.

Standard

Следующая команда создает кластер с одним узлом. Заменять имя-кластера с именем вашего кластера:

  кластеры контейнеров gcloud создают  имя-кластера  --num-nodes = 1
  

Автопилот

Следующая команда создает кластер автопилота.Заменять имя-кластера с именем вашего кластера:

  кластеры контейнеров gcloud create-auto  cluster-name 
  
Примечание: Создание кластера может занять несколько минут.

Получить учетные данные для аутентификации для кластера

После создания кластера вам необходимо получить учетные данные для аутентификации взаимодействовать с кластером:

кластеры контейнеров gcloud get-credentials  имя-кластера  

Эта команда настраивает kubectl для использования созданного вами кластера.

Развертывание приложения в кластере

Теперь, когда вы создали кластер, вы можете развернуть контейнерное приложение к нему. Для этого краткого руководства вы можете развернуть наш пример веб-сайта приложение, hello-app .

GKE использует объекты Kubernetes для создания и управления вашим ресурсы кластера. Kubernetes предоставляет Развертывание объект для развертывания приложений без сохранения состояния, таких как веб-серверы. Служба объекты определяют правила и балансировку нагрузки для доступа к вашему приложению из Интернета.

Создание развертывания

Чтобы запустить hello-app в кластере, выполните следующую команду:

kubectl создать развертывание hello-server --image = gcr.io / google-samples / hello-app: 1.0
 

Эта команда Kubernetes, kubectl создать развертывание , создает развертывание с именем hello-server . Развертывания Pod запускает образ контейнера hello-app .

В этой команде:

  • --image указывает образ контейнера для развертывания.В этом случае команда извлекает пример изображения из Реестр контейнеров ведро, gcr.io/google-samples/hello-app . : 1.0 указывает конкретную версию изображения для извлечения. Если вы не укажете версия, используется последняя версия.
Примечание: В этом руководстве вы используете образ контейнера из реестра контейнеров. Google Cloud также предоставляет универсальную службу управления пакетами, Реестр артефактов. Реестр артефактов поддерживает контейнеры и другие форматы, а также обеспечивает большую гибкость и контроль над вашими артефактами.Узнать больше о различиях между этими реестрами в Сравнение характеристик.

Разоблачение развертывания

После развертывания приложения его необходимо открыть в Интернете, чтобы пользователи могут получить к нему доступ. Вы можете раскрыть свое приложение, создав Сервис, Ресурс Kubernetes, который предоставляет ваше приложение внешнему трафику.

Чтобы открыть ваше приложение, запустите следующее kubectl выставить команда:

kubectl выставить развертывание hello-server --type LoadBalancer \
  --port 80 --target-port 8080
 

Передача флага --type LoadBalancer создает Compute Engine. балансировщик нагрузки для вашего контейнера.Флаг --port инициализирует общедоступный порт 80 в Интернет, а флаг --target-port направляет трафик в порт 8080 приложения.

балансировщиков нагрузки оплачиваются из расчета на Compute Engine расценки на балансировщик нагрузки.

Проверка и просмотр приложения

  1. Проверьте работающие модули с помощью kubectl get pods :

     kubectl get pods 

    Вы должны увидеть один hello-server Pod, работающий в вашем кластере.

  2. Проверьте службу hello-server с помощью kubectl получить обслуживание :

     kubectl получить сервис hello-server 

    Из выходных данных этой команды скопируйте внешний IP-адрес службы из EXTERNAL-IP колонка.

    Примечание: Возможно, вам придется подождать несколько минут, прежде чем служба внешний IP-адрес заполняется. Если внешний IP-адрес приложения <ожидание> , снова запустите kubectl и получите .
  3. Просмотрите приложение из веб-браузера, используя внешний IP-адрес с выставленным портом:

     http: //  внешний IP-адрес /

Вы только что развернули контейнерное веб-приложение для GKE.

Быстрый старт | Cloud Natural Language API | Google Cloud

На этой странице показано, как начать работу с Cloud Natural Language API с помощью Google Cloud SDK.

Прежде чем начать

  1. Войдите в свою учетную запись Google.

    Если у вас его еще нет, зарегистрируйте новую учетную запись.

  2. Настройте проект Cloud Console.

    Настроить проект

    Щелкните, чтобы:

    • Создайте или выберите проект.
    • Включите Cloud Natural Language API для этого проекта.
    • Создайте учетную запись службы.
    • Загрузите закрытый ключ в формате JSON.

    Вы можете просматривать и управлять этими ресурсами в любое время в Облачная консоль.

  3. Установите переменную среды GOOGLE_APPLICATION_CREDENTIALS на путь к файлу JSON, который содержит ключ вашей учетной записи службы. Эта переменная применяется только к вашему текущему сеансу оболочки, поэтому, если вы откроете новый сеанс, снова установите переменную.

    Пример: Linux или macOS

    Замените [ПУТЬ] на путь к файлу JSON, который содержит ключ вашей учетной записи службы.

     экспорт GOOGLE_APPLICATION_CREDENTIALS = " [ПУТЬ] " 

    Например:

     экспорт GOOGLE_APPLICATION_CREDENTIALS = "/ home / user / Downloads / service-account-file.json" 

    Пример: Windows

    Замените [ПУТЬ] на путь к файлу JSON, который содержит ключ вашей учетной записи службы.

    С PowerShell:

     $ env: GOOGLE_APPLICATION_CREDENTIALS = " [ПУТЬ] " 

    Например:

     $ env: GOOGLE_APPLICATION_CREDENTIALS = "C: \ Users \ username \ Downloads \  мой-ключ .json "

    С командной строкой:

     установить GOOGLE_APPLICATION_CREDENTIALS =  [ПУТЬ]  
  4. Установите и инициализируйте Cloud SDK.

Сделать запрос на анализ сущности

gcloud

Используйте инструмент командной строки gcloud для вызова команды analysis-entity . и используйте флаг --content для укажите текст для анализа.
gcloud ml language analysis-entity --content = "Микеланджело Караваджо, итальянский художник, известен благодаря" Призванию святого Матфея ".
 

Командная строка

Используйте curl , чтобы сделать запрос POST к документам : analyEntities метод и укажите соответствующий текст запроса, как показано ниже. пример.

В этом примере используется маркер доступа к печати по умолчанию для приложения gcloud auth команда для получения токена доступа для созданной вами учетной записи службы при настройке проекта.

curl -X POST \
  -H "Авторизация: предъявитель" $ (gcloud auth application-default print-access-token) \
  -H "Content-Type: application / json; charset = utf-8" \
 "https://language.googleapis.com/v1/documents:analyzeEntities" \
  --данные "{
  'документ':{
    'type': 'PLAIN_TEXT',
    'content': 'Микеланджело Караваджо, итальянский художник, известен
              \ 'Призвание святого Матфея \'. '
  },
  'encodingType': 'UTF8'
} "
 

Вы должны увидеть ответ, подобный следующему:

{
  "сущности": [
    {
      "name": "Микеланджело Караваджо",
      "тип": "ЛИЦО",
      "метаданные": {
        "wikipedia_url": "http: // en.wikipedia.org/wiki/Caravaggio ",
        "mid": "/ m / 020bg"
      },
      "заметность": 0,83047235,
      "упоминания": [
        {
          "text": {
            "content": "Микеланджело Караваджо",
            "beginOffset": 0
          },
          "тип": "ПРАВИЛЬНЫЙ"
        },
        {
          "text": {
            "content": "художник",
            "beginOffset": 33
          },
          "тип": "ОБЩИЙ"
        }
      ]
    },
    {
      "name": "итальянский",
      "type": "LOCATION",
      "метаданные": {
        "mid": "/ m / 03rjj",
        "wikipedia_url": "http: // en.wikipedia.org/wiki/Italy "
      },
      "заметность": 0.13870546,
      "упоминания": [
        {
          "text": {
            "content": "итальянский",
            "beginOffset": 25
          },
          "тип": "ПРАВИЛЬНЫЙ"
        }
      ]
    },
    {
      "name": "Призвание святого Матфея",
      "тип": "СОБЫТИЕ",
      "метаданные": {
        "mid": "/ m / 085_p7",
        "wikipedia_url": "http://en.wikipedia.org/wiki/The_Calling_of_St_Matthew_(Caravaggio)"
      },
      «заметность»: 0,030822212,
      "упоминания": [
        {
          "text": {
            "content": "Призвание святого Матфея",
            "beginOffset": 69
          },
          "тип": "ПРАВИЛЬНЫЙ"
        }
      ]
    }
  ],
  "язык": "ru"
}
 

Поздравляем! Вы отправили свой первый запрос в Cloud Natural Language API.

Вы также можете анализировать тональность документа и извлекать синтаксис аннотации из текста с помощью запросов к другому Cloud Natural Language API конечные точки. Увидеть Cloud Natural Language API Основы для более подробной информации.

Очистить

Чтобы избежать ненужных расходов на Google Cloud Platform, используйте Облачная консоль удалить свой проект, если он вам не нужен.

Что дальше

Краткое руководство по командной строке

— документация DNAnexus

Клиент командной строки dx включен в DNAnexus SDK ( dx-toolkit ).Вы можете использовать клиент dx для входа на платформу; загружать, просматривать и систематизировать данные; и запустить анализы.

Все проекты и данные, упомянутые в этом кратком руководстве, общедоступны, поэтому вы можете следовать им шаг за шагом.

В процессе работы вы можете использовать этот указатель команд dx в качестве справочника.

В командной строке вы также можете ввести dx help , чтобы увидеть список команд с разбивкой по категориям. Чтобы просмотреть список команд из определенной категории, введите dx help .

Чтобы узнать, что делает конкретная команда, введите dx help , dx -h или dx -help . Например, введите dx help ls , чтобы узнать о команда dx ls :

 

$ dx help ls

использование: dx ls [-h] [--color {off, on, auto}] [--delimiter [DELIMITER]]

[--env- помощь] [--brief | --сводка | --verbose] [-a] [-l] [--obj]

[--folders] [--full]

[путь]

Список папок и / или объектов в папке

... # вывод для краткости усечен

Чтобы использовать интерфейс командной строки (CLI), убедитесь, что вы установили DNAnexus Software Development Kit (SDK).

Чтобы обновить свою версию инструмента командной строки, вы можете запустить команду dx upgrade . Дополнительные сведения об обновлении SDK см. На странице «Загрузки».

Первое, что вам нужно сделать, это войти в систему. Если вы еще не создали учетную запись DNAnexus, посетите веб-сайт и зарегистрируйтесь.Регистрация пользователей не поддерживается в командной строке.

 

$ dx login

Получение учетных данных с https://auth.dnanexus.com

Имя пользователя: <ваше имя пользователя>

Пароль: <ваш пароль>

Нет проектов на выбор. Вы можете создать его с помощью команды «dx новый проект». Чтобы выбрать из проектов, для которых у вас есть разрешения только на ПРОСМОТР, используйте команду «dx select --level VIEW» или «dx select --public».

Ваш маркер аутентификации и текущие настройки проекта теперь сохранены в локальном файле конфигурации, и вы готовы начать доступ к своему проекту.

Заглянем внутрь некоторых уже созданных публичных проектов.

 

$ dx select --public --name «Справочные файлы генома *»

Доступные общедоступные проекты:

0) Справочные файлы генома: AWS China (VIEW)

1) Справочные файлы генома: Azure Amsterdam (VIEW)

2) Справочные файлы генома: AWS London (VIEW)

3) Справочные файлы генома: Azure US (Запад) (VIEW)

4) Справочные файлы генома: AWS Sydney (VIEW)

5) Справочные файлы генома: AWS Germany (VIEW)

6) Справочные файлы генома: AWS US (Восток) (ПРОСМОТР)

Выберите пронумерованный вариант: <6>

Установка текущего проекта на: Справочные файлы генома: AWS US (Восток)

Запустив команду dx select и выбрав проект, вы выполнили в командной строке, эквивалентную переходу на страницу проекта для файлов эталонного генома: AWS US (Восток) (для доступа к платформе требуется вход на платформу). эту ссылку) на сайте.Это спонсируемый DNAnexus проект, содержащий популярные геномы, которые вы можете использовать при анализе ваших собственных данных.

Дополнительную информацию о команде dx select см. На странице «Изменение текущего проекта».

ПРИМЕЧАНИЕ: С вас никогда не будет взиматься плата за данные, спонсируемые DNAnexus, поэтому вы можете бесплатно копировать данные из этого проекта сколько угодно раз.

Теперь вы можете перечислить все данные в каталоге верхнего уровня проекта, который вы только что выбрали, выполнив команду dx ls .Вы также можете увидеть содержимое папки, выполнив команду dx ls .

 

$ dx ls

C. Elegans - Ce10 /

D. melanogaster - Dm3 /

H. Sapiens - GRCh47 - b37 (1000 Genomes Phase I) /

H. Sapiens - GRCh47 - hs37d5 (1000 Фаза II) /

H. Sapiens - GRCh48 /

H. Sapiens - hg19 (Ion Torrent) /

H. Sapiens - hg19 (UCSC) /

M. musculus - мм10 /

M. musculus - мм9 /

$ dx ls "C.Elegans - Ce10 / "

ce10.bt2-index.tar.gz

ce10.bwa-index.tar.gz

...

Чтобы не вводить полное имя папки, введите dx ls C , а затем нажмите . Имя папки будет автоматически заполнено оттуда.

Вам не обязательно находиться в проекте, чтобы проверить его содержимое. Вы также можете просмотреть другой проект и папки внутри проекта, указав имя или идентификатор проекта, за которым следует двоеточие (: ) и путь к папке.Здесь мы перечисляем содержимое общедоступного проекта «Демо-данные», используя его имя и идентификатор.

 

$ dx ls "Демонстрационные данные: / SRR100022 /"

SRR100022_1.filt.fastq.gz

SRR100022_2.filt.fastq.gz

$ dx ls -l "project-BQbJpBj0b18009k000 / SRR1000 / 9000 / SRR1000 / 8GyQx000 / SRR10009000 / 9000 / SRR10001000 / Проект: демонстрационные данные (project-BQbJpBj0bvygyQxgQ1800Jkk)

Папка: / SRR100022

Состояние Последнее изменение Размер Имя (ID)

...

Как показано выше, вы можете использовать флаг -l вместе с флагом dx ls , чтобы получить более подробную информацию о файлах, например, время последнего изменения файла, его размер (если применимо) и его полный идентификатор DNAnexus.

Описание объектов DNAnexus

Вы можете использовать команду dx describe , чтобы узнать больше о файлах и других объектах на платформе. При наличии идентификатора или имени объекта DNAnexus команда dx describe вернет подробную информацию о рассматриваемом объекте. dx describe будет возвращать результаты только для объектов данных, к которым у вас есть доступ.

Помимо описания данных и проектов (примеры которых приведены ниже), вы также можете описывать приложения, задания и пользователей.

Пример: описание файла

Ниже мы описываем эталонный файл генома для C. elegans , расположенный в проекте «Reference Genome Files: AWS US (East)», который мы использовали (который должен быть доступны и из других регионов).

 

$ dx описать "Справочные файлы генома \: AWS US (Восток): / C. Elegans - Ce10 / ce10.fasta.gz"

Результат 1:

Идентификационный файл-BQbY9Bj015pB7JJVX0vQ7vj5

Файл проекта

Class Project -BQpp3Y804Y0xbyG4GJPQ01xv

Папка / C.Elegans - Ce10

Name ce10.fasta.gz

State closed

Visibility visible

Types -

Properties Assembly = UCSC ce10,

Origin = http: //hgdownload.cse.ucsc.edu/goldenPath/ce10 / bigZip

s / ce10.2bit, Виды = Caenorhabditis elegans, Таксономия

ID = 6239

Теги -

Исходящие ссылки -

Создано Вт 30 сентября 18:54:35 2014

Создано через bhannigan

задание job-BQbY8y80KKgP380QVQY000qz

Последнее изменение четверг, 2 марта 12:17:27 2017

Тип носителя application / x-gzip

archivalState "live"

Размер 29.21 МБ, спонсируется DNAnexus

Пример: описание проекта

Ниже мы описываем общедоступный проект Reference Genome Files, который мы использовали.

 

$ dx описать «Справочные файлы генома \: AWS US (Восток):»

Результат 1:

ID project-BQpp3Y804Y0xbyG4GJPQ01xv

Class project

Имя Справочные файлы генома: AWS

Summary

Оплачивается org-dnanexus

Уровень доступа ПРОСМОТР

Регион aws: us-east-1

Защищено true

Ограничено false

Содержит PHI false

Создано в среду, 8 октября, 16:42:53 2014

Создано tnguyen

Последнее изменение Вт, 23 октября, 14:15:59 2018

Использование данных 0.00 ГБ

Рекламные данные 519,77 ГБ

Спонсируемый исходящий трафик 0,00 ГБ из 0,00 ГБ всего

Теги -

Свойства -

загрузка Ограничено false

defaultInstanceType "mem2_hdd2_x2"

новый проект для создания нового проекта.

 

$ dx новый проект «Мой первый проект»

Создан новый проект под названием «Мой первый проект»

(project-xxxx)

Перейти на новый проект сейчас? [y / N]: y

Текст project-xxxx обозначает заполнитель для уникального неизменяемого идентификатора проекта.Дополнительные сведения об идентификаторах объектов см. На странице идентификаторов объектов.

Теперь вы готовы начать загрузку данных и выполнение собственного анализа!

Если у вас есть образец, который вы хотите проанализировать, вы можете использовать команду dx upload или агент загрузки, если вы его установили. Для целей этого руководства вы также можете загрузить файл small-celegans-sample.fastq, который представляет первые 25000 считываний C. elegans из SRR070372. Позже мы снова воспользуемся этим файлом, чтобы провести анализ образца.

ПРИМЕЧАНИЕ: Для загрузки нескольких или больших файлов мы настоятельно рекомендуем использовать агент загрузки; он сжимает ваши файлы и загружает их параллельно через несколько HTTP-соединений и может похвастаться другими функциями, такими как возобновляемая загрузка.

Следующая команда загружает файл small-celegans-sample.fastq в текущий каталог текущего проекта. Флаг --wait сообщает dx upload , что нужно дождаться завершения загрузки данных перед возвратом приглашения и описанием результата.

 

$ dx upload --wait small-celegans-sample.fastq

[================================= ============================>] Загружено (16801690 из 16801690 байт) 100% small-celegans-sample.fastq

ID файл -xxxx

Файл класса

Project project-xxxx

Папка /

Имя small-celegans-sample.fastq

Состояние закрыто

Видимость

Типы -

Свойства -

Теги -

Теги -

}

Исходящие ссылки -

Создано 1 января 09:00:00 2017

Создано amy

Последнее изменение Сб 1 января 09:00:00 2017

Тип носителя text / plain

Размер 16.02 MB

ПРИМЕЧАНИЕ: Если вы запустите ту же команду, но добавите флаг --brief , на терминал будет напечатан только идентификатор файла (в форме file-xxxx ). Другие команды dx также принимают флаг --brief и также сообщают только идентификаторы объектов.

Чтобы быстро взглянуть на первые несколько строк только что загруженного файла, используйте команду dx head . По умолчанию он печатает первые 10 строк, если задан файл.

Давайте запустим его для только что загруженного файла и воспользуемся флагом -n , чтобы запросить первые 12 строк (первые 3 чтения) файла FASTQ.

 

$ ой головы -n 12 стрелковый celegans-sample.fastq

@ длина SRR070372.1 FV5358E02GLGSF = 78

TTTTTTTTTTTTTTTTTTTTTTTTTTTNTTTNTTTNTTTNTTTATTTATTTATTTATTATTATATATATATATATATA длина

+ SRR070372.1 FV5358E02GLGSF = 78

... 000 ///// / 999999 <<< = << 666! 602! 777! 922! 688: 669A9 = <= 122569AAA?> @ BBBBAA? = <96632

@ SRR070372.2 Длина FV5358E02FQJUJ = 177

TTTCTTGTAATTTGTTGGAATACGAGAACATCGTCAATAATATATCGTATGAATTGAACCACACGGCACATATTTGAACTTGTTCGTGAAATTTAGCGAACCTGGCAGGACTCGAACCTCCAATCTTCGGATCCGAAGTCCGACGCCCCCGCGTCGGATGCGTTGTTACCACTGCTT длина

+ SRR070372.2 FV5358E02FQJUJ = 177

[электронная почта защищена]> C <[электронная почта защищена] 944 => =; 22499; CIIIIIIIIIIIIHHHIIIIIIIIIIIIIIIH ;;? ;? IIEEEEEEEEIIII77777I7EEIIEEHHHHHIIIIIIIIIIIIII

@ SRR070372.3 FV5358E02GYL4S length = 70

TTGGTATCATTGATATTCATTCTGGAGAACGATGGAACATACAAGAATTGTGTTAAGACCTGCATAAGGG

+ SRR070372.3 Загрузите 9065 файл 9065 с платформы 90d

+ SRR070372.3. Загрузите файл 9065 = 70d

Эта команда будет использовать имя файла в качестве имени файла, если вы не укажете свое собственное с флагом

-o / --output . В приведенном ниже примере мы загружаем тот же файл C. elegans , который мы загрузили ранее.

 

$ dx загрузить small-celegans-sample.fastq

[] Загружено 0 байт

[=========================== ================================>] Загружено 16.02 из

[========== =================================================> ] Завершено 16.02 из 16.02 байт (100%) small-celegans-sample.fastq

Файлы имеют разные доступные поля для метаданных, такие как «свойства» (пары ключ-значение) и «теги».

Для следующих нескольких шагов, если вы хотите продолжить, вам понадобится файл C. elegans FASTQ. Мы сопоставим чтения с геномом ce10. Если вы еще этого не сделали, вы можете загрузить и использовать следующий файл FASTQ, который содержит первые 25 000 операций чтения из SRR070372: small-celegans-sample.fastq.

ПРИМЕЧАНИЕ: При желании вы также можете заменить другой вид своим собственным файлом чтения (хотя просмотр примера может занять больше времени).Для вашего удобства DNAnexus уже импортировал на платформу множество эталонных геномов. Если у вас есть собственный файл FASTA, который вы хотели бы использовать, вы можете загрузить файл и создать индексы генома для BWA или Bowtie2 с помощью приложения BWA FASTA Indexer или Bowtie2 FASTA Indexer (для доступа к этим ссылкам требуется вход на платформу).

Следующее пошаговое руководство полезно, если вы хотите понять, что делают все команды, и посмотреть, какие приложения вы запускаете, но если вас просто интересует преобразование файла FASTQ, сжатого gzip, в файл VCF через BWA. и вызывающий вариант FreeBayes, то вы можете перейти к разделу Automate It ниже, где вы можете увидеть все команды, необходимые для запуска приложений.

Если вы еще не сделали этого, вы можете загрузить файл FASTQ для анализа.

 

$ dx upload small-celegans-sample.fastq --wait

Дополнительные сведения об использовании команды dx upload см. На странице dx upload .

Затем используйте приложение BWA-MEM (для доступа к этой ссылке требуется вход на платформу), чтобы сопоставить загруженный файл чтения с эталонным геномом.

Прежде всего, если вы не знаете имя в командной строке приложения, которое хотите запустить, у вас есть два варианта:

  1. Вы можете перейти на его веб-страницу со страницы приложений (вход на платформу требуется для доступа к этой ссылке) на платформе.На странице приложения вы узнаете, как запустить его из командной строки. Дополнительную информацию о приложении, которое мы запускаем, можно найти на странице BWA-MEM FASTQ Read Mapper (для доступа к этой ссылке требуется вход в платформу).

  2. Кроме того, вы можете искать приложения из командной строки, выполнив команду dx find apps . Вы найдете название приложения, которое вы можете использовать в командной строке, в круглых скобках (подчеркнуто ниже).

 

$ dx найти приложения

...

x BWA-MEM FASTQ Read Mapper (bwa_mem_fastq_read_mapper), v1.4.0

...

Теперь установите приложение с помощью dx install и убедитесь, что оно установлено. Хотя вам не всегда нужно устанавливать приложение для его запуска, вы можете найти его полезным в качестве инструмента для создания закладок.

 

$ dx install bwa_mem_fastq_read_mapper

Установлено приложение bwa_mem_fastq_read_mapper

$ dx find apps - установлено

BWA-MEM FASTQ Read Mapper (bwa_mem_fastq_read_mapper).4.0

Теперь мы можем запустить приложение, используя dx run . Запустим его без всяких аргументов; Затем он запросит у нас обязательные, а затем дополнительные аргументы. Обратите внимание, что эталонный файл genomeindex_targz для образца C. elegans , который мы используем, имеет формат .tar.gz и находится в папке Reference Genome региона, в котором находится ваш проект.

 

$ dx run bwa_mem_fastq_read_mapper

Переход в интерактивный режим для выбора входа.

Ввод: читает (reads_fastqgz)

Класс: file

Введите идентификатор файла или путь ( дважды для совместимых файлов в текущем каталоге, '?' Для справки)

reads_fastqgz [0]:

Ввод: индекс эталонного генома BWA (genomeindex_targz)

Класс: файл

Предложения:

project-BQpp3Y804Y0xbyG4GJPus File Genomes)

Введите идентификатор файла или путь (дважды для совместимых файлов в текущем каталоге

, '?' Для дополнительных параметров)

genomeindex_targz: <"Справочные файлы генома \: : / C.Elegans - Ce10 / ce10.bwa-index.tar.gz ">

Выберите необязательный параметр для установки его

[0] Чтения (правые сопряжения) (reads2_fastqgz)

[1] Добавить читать информацию о группе в сопоставлениях (требуется для нисходящего GATK)? (add_read_group) [default = true]

[2] Читать идентификатор группы (read_group_id) [default = {"$ dnanexus_link": {"input": "reads_fastqgz", "metadata": "name"}}]

[3] Чтение платформы группы (read_group_platform) [default = "ILLUMINA"]

[4] Чтение блока платформы группы (read_group_platform_unit) [default = "None"]

[ 5] Чтение групповой библиотеки (read_group_library) [default = "1"]

[6] Чтение образца группы (read_group_sample) [default = "1"]

[7] Вывести все выравнивания для одиночных / непарных чтений? (All_alignments)

[8] Отметить более короткие разделенные попадания как вторичные? (Mark_as_secondary) [default = true]

[9] Дополнительные параметры командной строки (advanced_options)

Необязательный параметр

Использование входных данных JSON:

{

"reads_fastqgz": {

"$ dnanexus_link": {

"project": "project-B3X8bjBqqBk1y7bVPkvQ000: 9000" file B3P6v02KZbFFkQ2xj0JQ005Y "

}

" genomeindex_targz ": {

" $ dnanexus_link ": {

" project ":" project-xxxx (идентификатор проекта

для эталонного генома) ":" file-BQbYJpQ09j3x9Fj30kf003JG "

}

}

}

Подтвердите запуск апплета / приложения с этим входом [Y / n]:

Вызов приложения-BPV2xV2 project-xxxx: /

Идентификатор задания: job-xxxx

Для отслеживания заданий можно использовать команду dx watch .Команда распечатает файл журнала задания, включая распечатки STDOUT, STDERR и INFO.

Вы также можете использовать команду dx describe job-xxxx , чтобы узнать больше о своей работе. Если вы не знаете идентификатор задания, вы можете использовать команду dx find jobs , чтобы вывести список всех заданий, запущенных в текущем проекте, вместе с пользователем, который их запускал, их статусом и временем начала.

 

$ dx find jobs

* BWA-MEM FASTQ Read Mapper (bwa_mem_fastq_read_mapper: main) (выполнено) job-xxxx

user-amy 20xx-xx-xx 0x: 00: 00 (время выполнения 0: 00: xx)

$ dx description job-xxxx

...

Существуют также дополнительные параметры, которые можно использовать для ограничения поиска предыдущих заданий, например, по их именам или времени выполнения.

Теперь вы должны увидеть два новых файла в своем проекте: сопоставленные чтения в файле BAM и индекс этого файла BAM с расширением .bai . Вы можете ссылаться на выходной файл по имени или по заданию, которое его создало, используя синтаксис job-xxxx: . Попробуйте сами с идентификатором вакансии, который вы получили при вызове приложения BWA-MEM!

 

$ dx ls

small-celegans-sample.bam

small-celegans-sample.bam.bai

small-celegans-sample.fastq

$ dx describe small-celegans-sample.bam

...

$ dx description job-xxxx: sorted_bam

...

Вы можете использовать приложение FreeBayes Variant Caller (для доступа к этой ссылке требуется вход в платформу) для вызова вариантов в вашем BAM-файле.

На этот раз мы не будем полагаться на интерактивный режим при вводе данных. Вместо этого мы предоставим их напрямую. Но сначала давайте посмотрим на спецификацию приложения, чтобы знать, как называются входы.Для этого запустим команду dx run freebayes -h .

 

$ dx run freebayes -h

использование: dx run freebayes [-iINPUT_NAME = VALUE ...]

Приложение: FreeBayes Variant Caller

Варианты вызовов (SNP, индексы и другие события) ) с помощью FreeBayes

Дополнительную информацию см. на странице приложения:

https://platform.dnanexus.com/app/freebayes

Входы:

Сортированные сопоставления: -isorted_bams = (file) [ -isorted_bams =... [...]]

Один или несколько файлов BAM с сортировкой по координатам, содержащих сопоставления для вызова

вариантов.

Геном: -igenome_fastagz = (file)

Файл в формате Gzip FASTA с эталонным геномом, с которым были сопоставлены чтения

.

...

Дополнительные входы показаны в квадратных скобках ( [] ) вокруг синтаксиса командной строки для каждого входа. Вы заметите, что необходимо указать два обязательных входа:

  1. Сортированные сопоставления ( sorted_bams ): список файлов с .bam расширение.

  2. Геном ( genome_fastagz ): эталонный геном в формате FASTA, сжатый с помощью gzip.

ПРИМЕЧАНИЕ: Вы также можете запустить dx description freebayes для более компактного просмотра входных и выходных спецификаций. По умолчанию он скрывает расширенные параметры ввода, но вы можете просмотреть их с помощью флага --verbose .

Запуск приложения в однострочном режиме с использованием объекта на основе задания Ссылка

Иногда удобнее запускать приложения с помощью одной однострочной команды.Вы можете сделать это, указав все необходимые входные данные либо через командную строку, либо в подготовленном файле. Мы будем использовать флаг -i для указания входных данных, как это предлагается в выходных данных команды dx run freebayes ‑h :

  • sorted_bams : выходных данных предыдущего шага BWA (дополнительную информацию см. ).

  • genome_fastagz : Геном ce10 в проекте Reference Genomes.

Чтобы указать ввод нового задания с использованием вывода предыдущего задания, мы будем использовать [ ссылка на объект на основе задания ] (/ Developer-Tutorials / Sample-Code? Bash # Use-job-based-object -references- (JBORs)) через синтаксис job-xxxx: , который мы использовали ранее.

ПРИМЕЧАНИЕ. Можно использовать ссылки на объекты на основе заданий в качестве входных данных, даже если до того, как задания, на которые имеются ссылки, завершатся. Система просто будет ждать, пока ввод будет готов, чтобы начать новую работу.

Замените приведенный ниже идентификатор задания на идентификатор, сгенерированный приложением BWA, которое вы запускали ранее. Флаг -y пропускает подтверждение ввода.

 

$ dx run freebayes -y \

-igenome_fastagz = Reference \ Genome \ Files: / C. \ Elegans \ - \ Ce10 / ce10.fasta.gz \

-isorted_bams = job-xxxx: sorted_bam

Использование входных данных JSON:

{

"genome_fastagz": {

"$ dnanexus_link": {

- "project": "project" xxxx ",

" id ":" file-xxxx "

}

},

" sorted_bams ": {

" field ":" sorted_bam ",

" job ":" job-xxxx "

}

}

Вызов app-BFG5k2009PxyvYXBBJY00BK1 с конечным адресом вывода

project-xxxx: /

Идентификатор задания: job-xxxx

9139 9137 9137 a Вы можете использовать команду dx wait , чтобы дождаться завершения задания.Если мы запустим следующую команду сразу после запуска приложения Freebayes, она покажет вам последние задания только после завершения задания, как показано в примере ниже.

 

$ dx wait job-xxxx && dx find jobs

Ожидание завершения работы job-xxxx ...

Done

* FreeBayes Variant Caller (done) job-xxxx

user-amy 2017-01- 01 09:00:00 (время выполнения 0:05:24)

...

Поздравляем! Вы вызвали варианты в образце чтения, и все это вы сделали в командной строке.Теперь давайте посмотрим, как можно автоматизировать этот процесс.

Прелесть интерфейса командной строки - это возможность автоматизировать процессы. Фактически, мы можем автоматизировать все, что только что сделали. В следующем сценарии предполагается, что вы уже вошли в систему, и он жестко запрограммирован для использования генома ce10 и принимает в качестве аргумента командной строки локальный сжатый файл FASTQ.

 

#! / Bin / bash

reference = "Справочные файлы генома: / C. Elegans - Ce10 / ce10.fasta.gz"

bwa_indexed_reference = "Справочные файлы генома: / C.Elegans - Ce10 / ce10.bwa-index.tar.gz "

local_reads_file =" $ 1 "

reads_file_id = $ (dx upload" $ local_reads_file "--brief)

bwa_job = $ (dx run bwa_mem_mem ireads_fastqgz = $ reads_file_id -igenomeindex_targz = "$ bwa_indexed_reference" -y --brief)

freebayes_job = $ (dx run freebayes -isorted_bams = $ bwa_job: sorted_bam -igenome_fast9000 9agzy = "

dx wait $ freebayes_job

dx загрузить $ freebayes_job: options_vcfgz -o "$ local_reads_file".vcf

Теперь вы готовы приступить к написанию сценариев с использованием dx . Как показано в некоторых из приведенных выше примеров, флаг --brief может пригодиться для написания сценариев. Список всех команд и флагов dx находится на странице Указатель команд dx.

Более подробную информацию о запуске приложений и апплетов из командной строки см. На странице «Запуск приложений и апплетов».

Полное руководство по SDK DNAnexus см. В документации SDK.

Хотите начать писать свои собственные приложения? Посетите портал разработчика, чтобы получить несколько полезных руководств.

Учебное пособие по использованию Asana для новых пользователей

Добро пожаловать в Asana!

Наши клиенты могут многого добиться с помощью Asana, но вот краткое изложение самых важных вещей, которые нужно знать, когда вы только начинаете.

Хотите, чтобы тренер провел вас через этот контент и ответил на ваши вопросы в режиме реального времени? Запишитесь на обучающий вебинар.

Зарегистрироваться сейчас

Прохождение демо-версии Quick Asana

Внешний вид и функции Asana постоянно развиваются - ваш экран, вероятно, выглядит иначе, чем на этом видео, - но ключевые концепции остаются теми же.

1. Как создать задачу

Все начинается с задачи. Задачи - это практические дела и самый важный строительный блок асаны.

Чтобы создать задачу, начните с проекта, введите имя задачи, затем нажмите введите , чтобы продолжать добавлять.

Передовой опыт выполнения задач

  • Сделайте имена задач конкретными и основанными на действиях, чтобы было понятно, что вам нужно делать. Добавьте описание задачи, чтобы исполнитель знал, что ему нужно делать.
  • Назначьте задачу товарищу по команде и установите срок выполнения (даже если это всего лишь предположение). Так понятно, кто за что отвечает.
  • Прикрепите файлы с любым соответствующим контекстом, информацией или рабочими документами. Кроме того, не забудьте прикрепить завершенные файлы, когда отмечаете задачу как выполненную, чтобы товарищи по команде могли найти вашу работу и знать, что она выполнена.
  • Добавьте товарищей по команде в качестве соавторов задачи, чтобы они могли быть в курсе хода выполнения задачи. Вы можете пинговать их, @ упоминая их, когда комментируете задачу.

2. Как создать свой первый проект

Проекты - это то, как вы организуете и планируете все задачи, связанные с конкретной инициативой, целью или большой частью работы. Вы можете визуализировать проекты в списке, доске, календаре или временной шкале и переключаться между этими представлениями в любое время.

Типы проектов, которыми можно управлять в Asana

Вы можете планировать и управлять практически любым проектом или процессом в Asana, но вот самые распространенные примеры:

Посмотрите другие примеры наших способов использования Asana или начните работу с готовым проектом в нашей библиотеке шаблонов.

3. Организуйте свой проект

Сгруппируйте связанные задачи вместе с разделами

Разделы группируют ваши задачи, упрощая синтаксический анализ проекта. Они наиболее полезны для категорий, которые не меняются по мере продвижения работы. Например, вы можете создавать разделы по временным рамкам (например, по кварталам или месяцам), фазам проекта или стилям Канбан «сделать», «сделать» и «сделать».

Сортировка и фильтрация задач в проектах с настраиваемыми полями

Настраиваемые поля похожи на заголовки столбцов электронной таблицы, которые помогают фильтровать и сортировать задачи в вашем проекте по таким параметрам, как приоритет, статус задачи, стоимость или утверждение.Сгруппируйте свой проект, щелкнув любой заголовок и используя кнопки фильтра и сортировки.

4. Как найти вашу работу и новости о ней

По мере того, как проекты продвигаются вперед, и на вашем пути появляется новая работа, Asana дает вам множество вариантов, чтобы оставаться на вершине. Откройте боковую панель, чтобы быстро увидеть:

Мои задачи

Мои задачи показывает только назначенные вам задачи и сроки их выполнения. Возвращайтесь в раздел "Мои задачи" в течение дня, чтобы отмечать выполненные задачи, просматривать новые задания и приступить к выполнению следующей задачи.

Входящие

Входящие - это отфильтрованная новостная лента обновлений, но только для работы, за которой вы следите . Вы также можете отвечать на сообщения прямо из папки «Входящие» и быстро переходить к работе.

5. Как организована Асана

Проекты и задачи - самые фундаментальные строительные блоки Asana.

  1. Организации основаны на общем домене электронной почты вашей компании и связывают всех в вашей компании, которые используют Asana.
  2. Команды - это функциональные группы в Организации, которые, вероятно, соответствуют общим командам, таким как маркетинг или продажи, или функциональным группам, таким как «Офис Нью-Йорка».
  3. Проекты хранятся в командах (и портфолио) для отслеживания всех действий, информации и коммуникаций для достижения цели, инициативы или задачи.
  4. Задачи хранятся в проектах и ​​позволяют понять, кто за что отвечает и когда. Задачи хранят все файлы, разговоры и инструкции, связанные с ними, поэтому их легко найти в одном месте.
  5. Портфолио магазина групп проектов. Вы можете использовать их для просмотра всех проектов и обновлений статуса в отношении инициативы или цели в одном месте.

Дополнительные ресурсы, которые помогут вам изучить Asana

Освоив основы, вы можете продолжать их развивать, и команда Asana тоже. У нас есть всевозможные ресурсы для начала работы, поэтому каждый может узнать, как ему нравится.

Быстрый запуск из командной строки | IPFS Docs

Если вы разбираетесь в командной строке и просто хотите сразу же приступить к работе с IPFS, следуйте этому краткому руководству.Обратите внимание, что в этом руководстве предполагается, что вы будете устанавливать go-ipfs, эталонную реализацию, написанную на Go.

СОВЕТ

Не хотите использовать командную строку прямо сейчас? Попробуйте реализацию IPFS в настольном приложении. Он также автоматически выполняет все шаги, перечисленные на этой странице, поэтому вы можете запускать IPFS с терминала позже, когда захотите. Загрузить IPFS Desktop сейчас (открывается в новом окне)

Предварительные требования

Если вы еще не установили Go-IPFS, следуйте инструкциям по установке.

Инициализировать репозиторий

ipfs хранит все свои настройки и внутренние данные в каталоге, который называется репозиторием. Перед использованием IPFS в первый раз вам необходимо инициализировать репозиторий с помощью команды ipfs init :

Если вы работаете на сервере в центре обработки данных, вы должны инициализировать IPFS с профилем сервера . Это предотвратит создание IPFS большого внутреннего трафика центра обработки данных, пытающегося обнаружить локальные узлы:

Существует целый ряд других параметров конфигурации, которые вы, возможно, захотите установить - проверьте полную ссылку (открывается в новом окне), чтобы узнать больше.

Хэш после идентификатора узла : - это идентификатор вашего узла, он будет отличаться от того, который показан в приведенных выше выходных данных. Другие узлы в сети используют его, чтобы найти вас и подключиться к вам. Вы можете запустить ipfs id в любое время, чтобы получить его снова, если он вам понадобится.

Теперь попробуйте выполнить команду, предложенную вам в выводе ipfs init . Тот, который выглядит как ipfs cat / ipfs / / readme .

Вы должны увидеть что-то вроде этого:

Вы можете исследовать другие объекты в репозитории.В частности, каталог быстрого запуска , в котором показаны примеры команд, которые можно попробовать:

Переведите свой узел в оперативный режим

Когда вы будете готовы присоединить свой узел к общедоступной сети, запустите демон ipfs в другом терминале и дождитесь всех три строки ниже, чтобы узнать, что ваш узел готов:

Запишите полученные TCP-порты. Если они разные, используйте свои в приведенных ниже командах.

Теперь вернитесь к исходному терминалу. Если вы подключены к сети, вы сможете увидеть IPFS-адреса своих сверстников при запуске:

Это комбинация <транспортный адрес> / p2p / .

Теперь у вас должна появиться возможность получать объекты из сети. Попробуйте:

Используя указанную выше команду, IPFS ищет в сети CID QmSgv ... и записывает данные в файл с именем spacehip-launch.jpg на вашем рабочем столе.

Затем попробуйте отправить объекты в сеть, а затем просмотреть их в своем любимом браузере. В приведенном ниже примере в качестве браузера используется curl , но вы также можете открыть URL-адрес IPFS в других браузерах:

Круто, да? Шлюз обслуживает файл с вашего компьютера .Шлюз запросил распределенную хеш-таблицу (DHT), нашел ваш компьютер, запросил файл, ваш компьютер отправил его на шлюз, а шлюз отправил его в ваш браузер.

В зависимости от состояния сети, curl может занять некоторое время. Общедоступные шлюзы могут быть перегружены или им сложно связаться с вами.

Вы также можете проверить это на собственном локальном шлюзе:

По умолчанию ваш шлюз не виден миру. Работает только локально.

Веб-консоль

Вы можете просмотреть веб-консоль на локальном узле, перейдя по адресу localhost: 5001 / webui (открывается в новом окне).Должна появиться такая консоль:

IPFS Companion

Пока мы на этом, IPFS Companion (открывается в новом окне) - это расширение браузера, которое упрощает доступ к ресурсам IPFS и добавляет поддержку протокола IPFS.

Он автоматически перенаправляет запросы шлюза IPFS вашему локальному демону, чтобы вы не полагались на удаленные шлюзы и не доверяли им.

Он работает в Firefox (настольный ПК и Android) и различных браузерах на основе Chromium, таких как Google Chrome или Brave (открывается в новом окне).
Ознакомьтесь с его функциями (открывается в новом окне) и установите его сегодня!

Устранение неполадок

Проверьте версию Go

IPFS работает с Go 1.12.0 или новее. Чтобы проверить, какая версия go у вас установлена, введите go версия :

Если вам нужно обновить, мы рекомендуем установить из канонических пакетов Go (открывается в новом окне). Менеджеры пакетов часто содержат устаревшие пакеты Go.

Убедитесь, что FUSE установлен.

Вам необходимо установить и настроить FUSE, чтобы смонтировать файловую систему.Для получения дополнительных сведений о настройке FUSE см. Github.com/ipfs/go-ipfs/blob/master/docs/fuse.md (открывается в новом окне)

Дополнительная помощь

Сообщество IPFS дружелюбно и готово помочь! Получите поддержку от других разработчиков IPFS на официальных форумах IPFS (открывается в новом окне) или присоединитесь к беседе в IRC.

% PDF-1.4 % 286 0 объект > эндобдж xref 286 73 0000000016 00000 н. 0000002343 00000 п. 0000002502 00000 н. 0000003673 00000 н. 0000004015 00000 н. 0000004464 00000 н. 0000004997 00000 н. 0000005111 00000 п. 0000005223 00000 п. 0000005570 00000 н. 0000005983 00000 п. 0000006068 00000 н. 0000006474 00000 н. 0000007000 00000 н. 0000007095 00000 н. 0000007567 00000 н. 0000008131 00000 п. 0000008906 00000 н. 0000009608 00000 н. 0000010306 00000 п. 0000010988 00000 п. 0000011577 00000 п. 0000012234 00000 п. 0000012953 00000 п. 0000041554 00000 п. 0000042159 00000 п. 0000044180 00000 п. 0000048139 00000 п. 0000052643 00000 п. 0000052760 00000 п. 0000062547 00000 п. 0000062582 00000 п. 0000062660 00000 п. 0000067968 00000 н. 0000068298 00000 п. 0000068364 00000 п. 0000068480 00000 п. 0000068515 00000 п. 0000068593 00000 п. 0000073030 00000 п. 0000073360 00000 п. 0000073426 00000 п. 0000073542 00000 п. 0000073577 00000 п. 0000073655 00000 п. 0000078378 00000 п. 0000078710 00000 п.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *