Блок ваз 11193: Блок цилиндров ВАЗ-11193 голый купить недорого с доставкой в «Не_выбран»

Содержание

Блок цилиндров ВАЗ. Особенности конструкции блока ВАЗ 21083, 2110, 2112, 11183, 21114, 21126, 11193, 11194

Блок цилиндров ВАЗ.

Особенности конструкции блоков цилиндров.

Блок цилиндров ВАЗ:  21083,  2110,  2112,  11183,  21126,  11193,  11194.

Блок цилиндров 21083 изначально создавался под карбюраторный двигатель и не предусматривал наличия мест крепления элементов имеющихся на инжекторных двигателях (датчика детонации, модуля зажигания и пр.). Позже, отливка модели была унифицирована и стала единой для моделей 21083, 2110 и 2112. Все эти модели отличает то, что они имеют одинаковую высоту и применяются на двигателях с объемом 1500 см куб. Поэтому, на корпусе всех этих блоков, в литье присутствует надпись – «21083». Сейчас с завода, в качестве запасной части, отгружается изделие с номенклатурным номером – 21083-100201100.

На корпусе «83-го» появились приливы, которые имеются на всех моделях блоков «переднеприводного» семейства двигателей. Но резьбовые отверстия присутствуют только на приливах, которые задействованы для установки оборудования. На унифицированном блоке цилиндров ВАЗ 21083, ниже места установки масляного фильтра, появился прилив и отверстия для установки датчика уровня масла. Для крепления головки блока на верхней плоскости имеются десять отверстий на М12х1.25. Блок цилиндров 21083 окрашивается в синий цвет.

После унификации «083-го», блок цилиндров ВАЗ 2110 утратил отличительные особенности, связанные с наличием дополнительных приливов на корпусе. Сейчас он внешне не отличается от «083-го». В БЦ 2110, для установки кронштейна правой опоры двигателя и установочной планки генератора, используются три резьбовых отверстия в верхней части и три отверстия в нижней части отливки, для кронштейна генератора.

Изделие устанавливается на «инжекторных» двигателях, поэтому на блоке цилиндров предусмотрено место для установки датчика детонации.

Как и в «083-м», предусматривается установка датчика уровня масла. Блок цилиндров 2110 может быть использован для сборки двигателя ВАЗ 21083. Блок 2110 окрашивается в серый цвет.

Блок цилиндров 2112, внешне не отличается от моделей 21083 и 2110, однако он не взаимозаменяем с ними. Особенность БЦ ВАЗ 2112 , являются крепежные отверстия для головки блока. Отверстия имеют размер М10х1.25. Есть еще одно существенное отличие блока. В 2-й, 3-й, 4-й и 5-й опорах коренных подшипников выполнены дополнительные каналы для масла, в которые запрессованы специальные масляные форсунки. Во время работы двигателя, через эти масляные форсунки масло под давлением, омывает днища поршней. Это значительно снижает термическую деформацию поршней и улучшает их смазку, особенно в момент запуска двигателя.

Все это в конечном счете, ведет к увеличению ресурса двигателя. Блок цилиндров 2112 окрашивается в серый цвет.

Блок цилиндров 21114 – результат модернизации модели 2110. Целью изменений было увеличение объема двигателя до 1.6 л. Для этого блок выполнен «высоким» — 197,1мм. Внешне, мод. 21114, не сильно отличается от мод. 2110. Особенность — исчез прилив и монтажные отверстия для датчика уровня масла в районе масляного фильтра. Для крепления головки блока используются отверстия резьбой М12х1.25. На блоке отсутствуют масляные форсунки для охлаждения поршней. Блок 21114 окрашивается в синий цвет.

В настоящее время АВТОВАЗ, прекратил выпуск блока 21114 и перешел на выпуск полностью взаимозаменяемой модели –

блок цилиндров ВАЗ 11183. На поверхности корпуса отлита надпись — «11183». Блок цилиндров 11183 окрашивается в серый цвет. В остальном, это точная копия мод. «21114-го».

Блок цилиндров 11193 устанавливается на двигатели ВАЗ 21124. Эта модель — результат доработки блока 2112. Увеличенная высота (197,1мм) цилиндров позволила довести объем двигателя до 1.6 л.

Блок 11193 сохранил особенности «2112-го»: крепежные отверстия для головки блока размером М10х1.25 и наличие специальных масляных форсунок для охлаждения поршней. Но на корпусе отсутствуют отверстия для датчика уровня масла. На корпусе имеется обозначение модели, надпись — «11193». Блок цилиндров 11193 окрашивается в серый цвет.

В сотрудничестве с фирмой Federal Mogul был создан новый двигатель ВАЗ 21126. Основной задачей стоявшей перед специалистами, было повышение ресурса двигателя и обеспечение соблюдения повышенных экологических норм по токсичности выхлопных газов. За основу был взят блок цилиндров ВАЗ 11193. Доработанное изделие получило новое обозначение – 21126. Блок цилиндров 21126 отличает качество обработки поверхности цилиндра, выполненного по технологии Federal Mogul. По этой технологии поверхность цилиндра подвергается плосковершинному хонингованию. Эта операция обеспечивает получение на поверхности цилиндра сетки микроканавок определенного профиля. Микропрофиль, позволяет удерживать смазку на поверхности цилиндра, значительно снижая потери на трение.

Технология хонингования, применяемая на АВТОВАЗе для обработки поверхности цилиндров предыдущих моделей, отличается от той, которая осуществляется на блоке цилиндров ВАЗ 21126. Фирмой Federal Mogul разработаны технологические параметры операции — угол наклона, профиль, частота нанесения микроканавок. Операция выполняется инструментом и с использованием оборудования этой фирмы. Повышение точности изготовления позволило определить для цилиндров только три группы размеров — A, B, C. Применение новой технологии в его изготовлении и нового поршневого комплекта (поршень+ кольца+палец+ шатун) от Federal Mogul, значительно повысили надежность работы двигателя.

Блок цилиндров 21126 окрашивается в синий цвет.

Блок цилиндров 11194, был специально разработан для двигателя с объемом 1,4л. С этой целью диаметр цилиндров был уменьшен до размера 76,5 мм. Внешне, конструктивно и по наличию мест для крепления оборудования, блок не отличается от модели 11193 или модели 21126. Однако блок цилиндров 11194 обладает скрытым отличием, эта особенность выгодно отличает его от других «переднеприводных» блоков.

Уменьшение диаметра цилиндров позволило выполнить протоки рубашки охлаждения между смежными цилиндрами. Это существенно улучшило отвод тепла и повысило жесткость конструкции. Обработка поверхности цилиндров осуществляется с применением технологии Federal Mogul, аналогично обработке выполняемой на «21126-м». На поверхности корпуса присутствует надпись – «11194». Блок цилиндров ВАЗ 11194 окрашивается в синий цвет.

Ваз 11193 фото


Двигатель ВАЗ 11193 – бюджетный вариант мотора

Двигатель ВАЗ Калина 11193 — это малобюджетная версия, которая была разработана специально для автомобилей Лада нового поколения. Силовой агрегат 11193 показал себя достаточно хорошо в процессе эксплуатации. Так, многие автолюбители, которые хотят сэкономить на автомобиле, выбирают именно Ладу Калину.

Технические характеристики

Технические характеристики мотора ВАЗ 11193 мало чем отличаются от своего предшественника 1118. По сути, моторы можно назвать идентичными, но все-же различия существуют. Итак, рассмотрим, техническую характеристику силового агрегата.

НаименованиеХарактеристика
МаркаЛада
Модель 11193
Объем двигателя1,6 литра (1596 см куб)
Мощность102
РасположениеПоперечно
Расход9,6 литра на каждые 100 км пробега
Количество цилиндров4
Количество клапанов16
Диаметр поршня82 мм
ОхлаждениеЖидкостное
ТопливоБензин (газ — как дополнительное оборудование)
Крутящий момент137 Нм

Двигатель ВАЗ 11193 стал логическим продолжение для семейства Калины, а также он устанавливается на 10-е поколение транспортных средств Лада.

Как видно, мотор является достаточно мощным и его хватает для такого небольшого автомобиля, как Калина. Если говорить о машинах 10-го поколения, то он достаточно слабоват.

Обслуживание мотора Калина 119

Техническое обслуживание для этого класса силовых агрегатов является однотипным. За рекомендацией завода изготовителя, проводить ТО необходимо каждые 15 000 км пробега. Но, как показывает практика, чем чаще и лучше проводить техническое обслуживание, тем большим будет ресурс. Так, установленный заводом АвтоВАЗ ресурс составляет 200 тыс. км, но если проводить обслуживание по следующей схеме, то двигатель ВАЗ 11193 может прослужить и все 300 000 км.

Итак, распишем, улучшенную схему обслуживания силового агрегата:

  • ТО-1: проводить после 5000 км пробега. При нем меняется масла и масляный фильтр. Также рекомендуется заменить топливный фильтрующий элемент. Это позволит топливной системе получать на начальном этапе эксплуатации более очищенное горючее, соответственно сберечь цилиндра и систему впрыска.
  • ТО-2: проводиться на 15000 км. Здесь необходимо заменить масло и фильтр, а также отрегулировать клапанный механизм.
  • ТО-3: 25000 км. Проведение этого технического обслуживания предусматривает стандартную замену масляного фильтра и смазки движка, а также меняется топливный и воздушный фильтр, прокладка клапанной крышки. В данном ТО также необходимо провести диагностику все датчиков и систем двигателя.
  • ТО-4: делается спустя 40 000 км пробега. Так, в данном случае, кроме замены стандартных элементов, таких как масло и фильтр, стоит заменить комплект газораспределительного механизм. Стоит отметить, что несвоевременная смена этого расходника может привести к худшим последствиям для мотора.

Последующие техническое обслуживание проводиться каждые 10-12 тыс. км по заданной схеме. Это сможет увеличить ресурс мотора на 50 000 — 60 000 км пробега, а если все нормально, то и на все 100 тыс. км.

Ремонт силового агрегата

Ремонтировать силовой агрегат ВАЗ 11193 достаточно просто, поскольку по конструктивным особенностям он мало чем отличается от 1118 и его модификаций. Единственным типовым конструктивным отличием является шестнадцати клапанная головка блока цилиндров и улучшенный вариант водяного насоса. Но, даже с этим может справиться не опытный автомобилист.

Как раннее указывалось, некоторые элементы двигателя стоит менять вовремя. Так, несвоевременная замена ремня ГРМ, может привести к согнутым клапанам, и еще более худших последствий. Таким образом, ремонтные операции стоит выполнять вовремя.

Инструкции по ремонту и диагностике можно найти в глобальной сети, или еще прощу найти книгу по ремонту и эксплуатации автомобилей семейства Лада Калина, которая выпущена заводом изготовителем. Здесь имеется вся необходимая информация для проведения ремонтных операций и обслуживания двигателя автомобиля.

Тюнинг и доработка

Доработка мотора ВАЗ 11193 проводиться достаточно легко. Так, процесс тюнинга делиться на два этапа, которые можно проводить вместе или по раздельности: программный и механический. Начнем с более распространенного варианта — электронного.

Пожалуй, почти каждый автолюбитель слышал о таком виде доработки, как чип тюнинг. Это прошивка бортового компьютера на выполнение определенных функций. Так, чип тюнинг бывает трех видов: стандартный, на мощность, на экономичность. В зависимости от того, что требуется автолюбителя, так и программируется ЭБУ.

Механический вариант доработки не распространенный, поскольку стоит достаточно дорого и отнимает много времени. Так, первое что дорабатывается — это поршневая группу. При этом происходит расточка стенок цилиндров под новые поршни, а сами элементы покупаются облегченные от производителя ATF. Также, на ряду с поршневой группой меняются и шатуны, а также вкладыши.

Вторым этапом доработки становится установка спортивных распределительных валов и замена клапанного механизма на более облегченный. Для шестнадцати клапанной Калины производитель DEF предлагает целый комплект улучшенных деталей, а именно: клапана, седла, направляющие втулки, распределительные валы и сальники.

Последним этапом становиться наружная доработка. В данном случае, проводится замена патрубков системы охлаждения (на силиконовые), смена водяного насоса, а также меняется генератор. Последней доработкой двигателя становится установка спортивного воздушного фильтра и дросселя. Все эти доработки позволят увеличить мощностные характеристики мотора и добавить до 50 лошадиных сил.

Вывод

Двигатель ВАЗ 11193 является продолжением полюбившегося силового агрегата 1118. Так, мотор показал себя с положительной стороны. Как показала практика, он достаточно простой в техническом обслуживании и ремонте, а ценовая политика на расходники — низкая, что позволяет этому мотору оставаться в бюджетной ценовой категории.

Также, с легкостью проводится поверхностный тюнинг, а вот если автолюбитель хочет большего, то придется обратиться к профессионалам.

Различия БЦ ВАЗ: 21083, 2110, 2112, 11183, 21126, 11193, 11194.

— Лада 2101, 1.5 л., 1980 года на DRIVE2

Данный пост поможет разобраться с двигателями переднеприводного семейства ваз) мне помог с выбором будущего турбодвижка, думаю кому нибудь еще понадобится) и так начнем…Блок цилиндров 21083 изначально создавался под карбюраторный двигатель и не предусматривал наличия мест крепления элементов имеющихся на инжекторных двигателях (датчика детонации, модуля зажигания и пр.). Позже, отливка модели была унифицирована и стала единой для моделей 21083, 2110 и 2112. Все эти модели отличает то, что они имеют одинаковую высоту и применяются на двигателях с объемом 1500 см куб. Поэтому, на корпусе всех этих блоков, в литье присутствует надпись – «21083». Сейчас с завода, в качестве запасной части, отгружается изделие с номенклатурным номером – 21083-100201100.На корпусе «83-го» появились приливы, которые имеются на всех моделях блоков «переднеприводного» семейства двигателей. Но резьбовые отверстия присутствуют только на приливах, которые задействованы для установки оборудования. На унифицированном блоке цилиндров ВАЗ 21083, ниже места установки масляного фильтра, появился прилив и отверстия для установки датчика уровня масла. Для крепления головки блока на верхней плоскости имеются десять отверстий на М12х1.25. Блок цилиндров 21083 окрашивается в синий цвет.После унификации «083-го», блок цилиндров ВАЗ 2110 утратил отличительные особенности, связанные с наличием дополнительных приливов на корпусе. Сейчас он внешне не отличается от «083-го». В БЦ 2110, для установки кронштейна правой опоры двигателя и установочной планки генератора, используются три резьбовых отверстия в верхней части и три отверстия в нижней части отливки, для кронштейна генератора. Изделие устанавливается на «инжекторных» двигателях, поэтому на блоке цилиндров предусмотрено место для установки датчика детонации.Как и в «083-м», предусматривается установка датчика уровня масла. Блок цилиндров 2110 может быть использован для сборки двигателя ВАЗ 21083. Блок 2110 окрашивается в серый цвет.

Блок цилиндров 2112, внешне не отличается от моделей 21083 и 2110, однако он не взаимозаменяем с ними. Особенность БЦ ВАЗ 2112 , являются крепежные отверстия для головки блока. Отверстия имеют размер М10х1.25. Есть еще одно существенное отличие блока. В 2-й, 3-й, 4-й и 5-й опорах коренных подшипников выполнены дополнительные каналы для масла, в которые запрессованы специальные масляные форсунки. Во время работы двигателя, через эти масляные форсунки масло под давлением, омывает днища поршней. Это значительно снижает термическую деформацию поршней и улучшает их смазку, особенно в момент запуска двигателя. Все это в конечном счете, ведет к увеличению ресурса двигателя. Блок цилиндров 2112 окрашивается в серый цвет.

Блок цилиндров 21114 – результат модернизации модели 2110. Целью изменений было увеличение объема двигателя до 1.6 л. Для этого блок выполнен «высоким» — 197,1мм. Внешне, мод. 21114, не сильно отличается от мод. 2110. Особенность — исчез прилив и монтажные отверстия для датчика уровня масла в районе масляного фильтра. Для крепления головки блока используются отверстия резьбой М12х1. 25. На блоке отсутствуют масляные форсунки для охлаждения поршней. Блок 21114 окрашивается в синий цвет.В настоящее время АВТОВАЗ, прекратил выпуск блока 21114 и перешел на выпуск полностью взаимозаменяемой модели – блок цилиндров ВАЗ 11183. На поверхности корпуса отлита надпись — «11183». Блок цилиндров 11183 окрашивается в серый цвет. В остальном, это точная копия мод. «21114-го».

Блок цилиндров 11193 устанавливается на двигатели ВАЗ 21124. Эта модель — результат доработки блока 2112. Увеличенная высота (197,1мм) цилиндров позволила довести объем двигателя до 1.6 л.

Блок 11193 сохранил особенности «2112-го»: крепежные отверстия для головки блока размером М10х1.25 и наличие специальных масляных форсунок для охлаждения поршней. Но на корпусе отсутствуют отверстия для датчика уровня масла. На корпусе имеется обозначение модели, надпись — «11193». Блок цилиндров 11193 окрашивается в серый цвет.В сотрудничестве с фирмой Federal Mogul был создан новый двигатель ВАЗ 21126. Основной задачей стоявшей перед специалистами, было повышение ресурса двигателя и обеспечение соблюдения повышенных экологических норм по токсичности выхлопных газов. За основу был взят блок цилиндров ВАЗ 11193. Доработанное изделие получило новое обозначение – 21126. Блок цилиндров 21126 отличает качество обработки поверхности цилиндра, выполненного по технологии Federal Mogul. По этой технологии поверхность цилиндра подвергается плосковершинному хонингованию. Эта операция обеспечивает получение на поверхности цилиндра сетки микроканавок определенного профиля. Микропрофиль, позволяет удерживать смазку на поверхности цилиндра, значительно снижая потери на трение. Технология хонингования, применяемая на АВТОВАЗе для обработки поверхности цилиндров предыдущих моделей, отличается от той, которая осуществляется на блоке цилиндров ВАЗ 21126. Фирмой Federal Mogul разработаны технологические параметры операции — угол наклона, профиль, частота нанесения микроканавок. Операция выполняется инструментом и с использованием оборудования этой фирмы. Повышение точности изготовления позволило определить для цилиндров только три группы размеров — A, B, C. Применение новой технологии в его изготовлении и нового поршневого комплекта (поршень+ кольца+палец+ шатун) от Federal Mogul, значительно повысили надежность работы двигателя. Блок цилиндров 21126 окрашивается в синий цвет.

Блок цилиндров 11194, был специально разработан для двигателя с объемом 1,4л. С этой целью диаметр цилиндров был уменьшен до размера 76,5 мм. Внешне, конструктивно и по наличию мест для крепления оборудования, блок не отличается от модели 11193 или модели 21126. Однако блок цилиндров 11194 обладает скрытым отличием, эта особенность выгодно отличает его от других «переднеприводных» блоков.

Уменьшение диаметра цилиндров позволило выполнить протоки рубашки охлаждения между смежными цилиндрами. Это существенно улучшило отвод тепла и повысило жесткость конструкции. Обработка поверхности цилиндров осуществляется с применением технологии Federal Mogul, аналогично обработке выполняемой на «21126-м». На поверхности корпуса присутствует надпись – «11194». Блок цилиндров ВАЗ 11194 окрашивается в синий цвет.

Лада Калина Хэтчбек ВАЗ-11193 на DRIVE2.RU

Блок цилиндров ВАЗ. Особенности конструкции блока ВАЗ 21083, 2110, 2112, 11183, 21114, 21126, 11193, 11194

Особенности конструкции блоков цилиндров.

Блок цилиндров ВАЗ:  21083,  2110,  2112,  11183,  21126,  11193,  11194.

Блок цилиндров 21083 изначально создавался под карбюраторный двигатель и не предусматривал наличия мест крепления элементов имеющихся на инжекторных двигателях (датчика детонации, модуля зажигания и пр.). Позже, отливка модели была унифицирована и стала единой для моделей 21083, 2110 и 2112. Все эти модели отличает то, что они имеют одинаковую высоту и применяются на двигателях с объемом 1500 см куб. Поэтому, на корпусе всех этих блоков, в литье присутствует надпись – «21083». Сейчас с завода, в качестве запасной части, отгружается изделие с номенклатурным номером – 21083-100201100.

На корпусе «83-го» появились приливы, которые имеются на всех моделях блоков «переднеприводного» семейства двигателей. Но резьбовые отверстия присутствуют только на приливах, которые задействованы для установки оборудования. На унифицированном блоке цилиндров ВАЗ 21083, ниже места установки масляного фильтра, появился прилив и отверстия для установки датчика уровня масла. Для крепления головки блока на верхней плоскости имеются десять отверстий на М12х1.25. Блок цилиндров 21083 окрашивается в синий цвет.

После унификации «083-го», блок цилиндров ВАЗ 2110 утратил отличительные особенности, связанные с наличием дополнительных приливов на корпусе. Сейчас он внешне не отличается от «083-го». В БЦ 2110, для установки кронштейна правой опоры двигателя и установочной планки генератора, используются три резьбовых отверстия в верхней части и три отверстия в нижней части отливки, для кронштейна генератора. Изделие устанавливается на «инжекторных» двигателях, поэтому на блоке цилиндров предусмотрено место для установки датчика детонации.

Как и в «083-м», предусматривается установка датчика уровня масла. Блок цилиндров 2110 может быть использован для сборки двигателя ВАЗ 21083. Блок 2110 окрашивается в серый цвет.

Блок цилиндров 2112, внешне не отличается от моделей 21083 и 2110, однако он не взаимозаменяем с ними. Особенность БЦ ВАЗ 2112 , являются крепежные отверстия для головки блока. Отверстия имеют размер М10х1.25. Есть еще одно существенное отличие блока. В 2-й, 3-й, 4-й и 5-й опорах коренных подшипников выполнены дополнительные каналы для масла, в которые запрессованы специальные масляные форсунки. Во время работы двигателя, через эти масляные форсунки масло под давлением, омывает днища поршней. Это значительно снижает термическую деформацию поршней и улучшает их смазку, особенно в момент запуска двигателя. Все это в конечном счете, ведет к увеличению ресурса двигателя. Блок цилиндров 2112 окрашивается в серый цвет.

Блок цилиндров 21114 – результат модернизации модели 2110. Целью изменений было увеличение объема двигателя до 1.6 л. Для этого блок выполнен «высоким» — 197,1мм. Внешне, мод. 21114, не сильно отличается от мод. 2110. Особенность — исчез прилив и монтажные отверстия для датчика уровня масла в районе масляного фильтра. Для крепления головки блока используются отверстия резьбой М12х1.25. На блоке отсутствуют масляные форсунки для охлаждения поршней. Блок 21114 окрашивается в синий цвет.

В настоящее время АВТОВАЗ, прекратил выпуск блока 21114 и перешел на выпуск полностью взаимозаменяемой модели – блок цилиндров ВАЗ 11183. На поверхности корпуса отлита надпись — «11183». Блок цилиндров 11183 окрашивается в серый цвет. В остальном, это точная копия мод. «21114-го».

Блок цилиндров 11193 устанавливается на двигатели ВАЗ 21124. Эта модель — результат доработки блока 2112. Увеличенная высота (197,1мм) цилиндров позволила довести объем двигателя до 1.6 л.

Блок 11193 сохранил особенности «2112-го»: крепежные отверстия для головки блока размером М10х1.25 и наличие специальных масляных форсунок для охлаждения поршней. Но на корпусе отсутствуют отверстия для датчика уровня масла. На корпусе имеется обозначение модели, надпись — «11193». Блок цилиндров 11193 окрашивается в серый цвет.

В сотрудничестве с фирмой Federal Mogul был создан новый двигатель ВАЗ 21126. Основной задачей стоявшей перед специалистами, было повышение ресурса двигателя и обеспечение соблюдения повышенных экологических норм по токсичности выхлопных газов. За основу был взят блок цилиндров ВАЗ 11193. Доработанное изделие получило новое обозначение – 21126. Блок цилиндров 21126 отличает качество обработки поверхности цилиндра, выполненного по технологии Federal Mogul. По этой технологии поверхность цилиндра подвергается плосковершинному хонингованию. Эта операция обеспечивает получение на поверхности цилиндра сетки микроканавок определенного профиля. Микропрофиль, позволяет удерживать смазку на поверхности цилиндра, значительно снижая потери на трение.

Технология хонингования, применяемая на АВТОВАЗе для обработки поверхности цилиндров предыдущих моделей, отличается от той, которая осуществляется на блоке цилиндров ВАЗ 21126. Фирмой Federal Mogul разработаны технологические параметры операции — угол наклона, профиль, частота нанесения микроканавок. Операция выполняется инструментом и с использованием оборудования этой фирмы. Повышение точности изготовления позволило определить для цилиндров только три группы размеров — A, B, C. Применение новой технологии в его изготовлении и нового поршневого комплекта (поршень+ кольца+палец+ шатун) от Federal Mogul, значительно повысили надежность работы двигателя. Блок цилиндров 21126 окрашивается в синий цвет.

Блок цилиндров 11194, был специально разработан для двигателя с объемом 1,4л. С этой целью диаметр цилиндров был уменьшен до размера 76,5 мм. Внешне, конструктивно и по наличию мест для крепления оборудования, блок не отличается от модели 11193 или модели 21126. Однако блок цилиндров 11194 обладает скрытым отличием, эта особенность выгодно отличает его от других «переднеприводных» блоков.

Уменьшение диаметра цилиндров позволило выполнить протоки рубашки охлаждения между смежными цилиндрами. Это существенно улучшило отвод тепла и повысило жесткость конструкции. Обработка поверхности цилиндров осуществляется с применением технологии Federal Mogul, аналогично обработке выполняемой на «21126-м». На поверхности корпуса присутствует надпись – «11194». Блок цилиндров ВАЗ 11194 окрашивается в синий цвет.

расточка Блока Ваз 11193, замена поршневой 21126 СТК, замена клапанов… — Лада Приора Седан, 1.6 л., 2010 года на DRIVE2

Вскрытие блока показала что все печально. Под замену почти все. Подумал и решил собрать все сам.

Доставили двигатель через низ вдвоем:) Все прошло замечательно…все запчасти остались целы и невредимы…

Разобрали все внутренности и навесное блока 11193 минут за 20…

Как бывает…

тот же поршень только с другой стороны… еще хуже 🙁

Заместо старой разной поршневой купил Поршни «СТК» ВАЗ 21126 — 82.5 (Безвтыковые с антифрикционным покрытием)

Поршни «СТК» ВАЗ 21126 — 82.5 (Безвтыковые с антифрикционным покрытием)под коленвал 75,6 мм в блок 197,1 мм, под шатуны 133,3 мм и пальцы d18 мм) кольца 1,2 мм/1,5 мм/2,0 мм

СТК безвтыковые с вытеснителем Чтобы компенсировать Степень сжатия, на поршнях имеется вытеснитель, и как утверждает производитель, степень сжатия с данными поршнями остается не изменой.

Головку 21126 тоже пришлось разбирать 🙁 погнула 4 клапа…Разбирается все очень быстро минут за 15 с помощью головки и молотка, главное не потерять сухари 🙂

На переднем плане погнутый клапан марки FM, сзади новый клапан SM )

А вот когда дело дошло до сборки, пришлось попотеть 🙂 Притирка клапанов не очень сложная вещь, но трудоёмкая время убивает нормально…притирал клапана ручным инструментом. Самое легкое это вставлять сальники клапанов 🙂

Комплект сальников клапанов ваз 2110-12 Марка: CORTECO, Италия 16-ти кл 16шт

Ну и самое главное поставить сухари на место, это конечно долгое дело…Делали вдвоем с mazz72rus Убили 6 литров пива и 2 бутылки вина, но сделали все 16 клапов…Процесс сборки головки описывать не буду т.к информации в красочных картинках очень много! 🙂 Только добавлю что нужно терпение :)))) и самое главное прямые руки!

Мой набор для сборки головки ваз 21126 (клипса для гофры 16мм подкладываем под клапан, маркер подписываем клапана чтобы не запутаться, кочерга для засухаривания…и т.д 🙂

SM клапы

Кто может проконсультировать по шатунам…так и должно быть?

Так и должно быть?

Цена вопроса: 100 500 ₽ Пробег: 120077 км

Page 2

Вскрытие блока показала что все печально. Под замену почти все. Подумал и решил собрать все сам.

Доставили двигатель через низ вдвоем:) Все прошло замечательно…все запчасти остались целы и невредимы…

Разобрали все внутренности и навесное блока 11193 минут за 20…

Как бывает…

тот же поршень только с другой стороны… еще хуже 🙁

Заместо старой разной поршневой купил Поршни «СТК» ВАЗ 21126 — 82.5 (Безвтыковые с антифрикционным покрытием)

Поршни «СТК» ВАЗ 21126 — 82.5 (Безвтыковые с антифрикционным покрытием)под коленвал 75,6 мм в блок 197,1 мм, под шатуны 133,3 мм и пальцы d18 мм) кольца 1,2 мм/1,5 мм/2,0 мм

СТК безвтыковые с вытеснителем Чтобы компенсировать Степень сжатия, на поршнях имеется вытеснитель, и как утверждает производитель, степень сжатия с данными поршнями остается не изменой.

Головку 21126 тоже пришлось разбирать 🙁 погнула 4 клапа…Разбирается все очень быстро минут за 15 с помощью головки и молотка, главное не потерять сухари 🙂

На переднем плане погнутый клапан марки FM, сзади новый клапан SM )

А вот когда дело дошло до сборки, пришлось попотеть 🙂 Притирка клапанов не очень сложная вещь, но трудоёмкая время убивает нормально…притирал клапана ручным инструментом. Самое легкое это вставлять сальники клапанов 🙂

Комплект сальников клапанов ваз 2110-12 Марка: CORTECO, Италия 16-ти кл 16шт

Ну и самое главное поставить сухари на место, это конечно долгое дело…Делали вдвоем с mazz72rus Убили 6 литров пива и 2 бутылки вина, но сделали все 16 клапов…Процесс сборки головки описывать не буду т.к информации в красочных картинках очень много! 🙂 Только добавлю что нужно терпение :)))) и самое главное прямые руки!

Мой набор для сборки головки ваз 21126 (клипса для гофры 16мм подкладываем под клапан, маркер подписываем клапана чтобы не запутаться, кочерга для засухаривания…и т.д 🙂

SM клапы

Кто может проконсультировать по шатунам…так и должно быть?

Так и должно быть?

Цена вопроса: 100 500 ₽ Пробег: 120077 км

Блок цилиндров ВАЗ 11193 Калина в сборе с коленвалом и поршневой группой (объем 1.6 л.)

Автомобили Отечественные
Типы Легковые
Модель 2119
Марка Ваз
Товары Блоки цилиндров
Производитель Ladamaster

Рабочий объем: 1,6л.
Межцентровое расстояние цилиндров: 89мм.
Диаметр цилиндра: 82мм.
Ход поршня: 75,6мм.
Комплект поставки: блок цилиндров, коленчатый вал, подшипники, поршни с пальцами и кольцами, шатуны.
Маркировка в литье: 11193.
Цвет: серый.

Отвечают специалисты ваза, газа — журнал За рулем

На ВАЗе:

1. У меня VAZ 21101 от января 2006 года. По ПТС и шильдику под капотом — двигатель 21114, 1,6 л. А что означают цифры 11193 на блоке и 21118 — на головке блока? Говорят, что эта головка от мотора 1,8 л…

Очевидно, речь идет не о выбитых цифрах модели и номера двигателя (головка вообще не номерной узел), а о маркировке отливок.

Блок цилиндров двигателя VAZ 21114 объемом 1,6 л отличается по высоте от блока 1,5-литровых двигателей 21083, 2110, 2111, поэтому маркируется в литье цифрами 11193 (у 1,5 л маркировка 21082). Из отливки 11193 делают также блоки двигателей VAZ 21124 (1,6 л, 16 клапанов).

Головка блока 1,6-литрового двигателя VAZ 21114 также отличается от головки двигателей 21083, 2110, 2111, поэтому ее заготовка маркируется отлитыми цифрами 1118 (1,5 л — 21083).

Отливки с маркировкой 21118 не существует. Вероятно, за цифру 2 ошибочно принят след от отверстия выталкивателя в технологической литейной оснастке, расположенного перед цифрами 1118.

2. Чем отличаются комплектации автомобилей VAZ 2115—22-030 и VAZ 2115—22-031?

Первая цифра 2 означает, что автомобиль оборудован системой впрыска топлива. Вторая цифра 2 указывает на исполнение «люкс». Последние цифры 030 и 031 — варианты комплектации. По документам они различаются только наружными зеркалами. Комплектация 031 оборудована зеркалами 2108, а 030 — зеркалами 2114.

Поскольку производство зеркал 2114 не было освоено, комплектация 030 не выпускалась и существует только в заводских документах.

3. На моей «Ниве» VAZ 21213 задняя часть генератора вроде бы защищена резиновым «хоботом». Зачем он нужен, если остальное открыто всем ветрам с грязью, водой и т.д.? У соседа на «Ниве» VAZ 21214 такого устройства уже нет. Так в чем же задача «хобота»?

Генератор 21213 создан на базе генератора 2108. Его охлаждение организовано так, что крыльчатка обдува отсасывает воздух через весь генератор. Для повышения долговечности щеточного узла и подшипников применяется специальная задняя крышка с воздухозаборником, выведенным в верхнюю часть моторного отсека, где воздух чище.

Генератор 21214 значительно отличается от предыдущего — у него иная конструкция подшипниковых и щеточных узлов, по-другому организовано охлаждение. Он надежней работает в запыленной среде и в «хоботе» не нуждается.

4. Говорят, контакты замков зажигания при сборке чем-то смазывают. Верно ли это и к каким замкам применимо?

Для замков зажигания «классики» и «Нивы» применялась специальная смазка КСБ с медными чешуйками, чтобы предотвратить окисление контактов. Для замков переднеприводных автомобилей такая смазка не требуется, поскольку контакты изготовлены из другого материала.

На ГАЗе:

1. Недавно убедился в том, о чем раньше слышал от других водителей: если придется буксировать «Волгой» GAZ 31105/»>GAZ 31105 другую машину, как цеплять к ней трос — за детали снизу кузова? Несерьезно.

Автомобиль GAZ 31105/»>GAZ 31105 не предназначен для использования в качестве буксировщика и поэтому не имеет специальных приспособлений для крепления троса. Крепить трос за стремянку правой рессоры, как делалось на ранее выпущенных автомобилях, не рекомендуем — можете повредить пластмассовый буфер.

2. Где можно получить официальную информацию о том, какие модели автомобилей ГАЗ ныне выпускаются?

Официальный перечень выпускаемых ОАО «ГАЗ» автомобилей вы найдете на сайте ОАО «ГАЗ»: www.gaz.ru.

3. У меня «Волга» GAZ 31105. В свете недавних заявлений о ее дальнейшей судьбе хотел бы уточнить: будет ли завод поставлять запчасти к машинам, снимаемым с производства?

В случае прекращения выпуска транспортного средства производство запасных частей для него будет продолжаться, как того требует Закон «О защите прав потребителей». Что касается «Волги» GAZ 31105/»>GAZ 31105, то ее выпуск решено продолжать до тех пор, пока этот автомобиль остается востребован рынком.

4. Каковы перспективы дизелизации «Газели»? Какие дизели, помимо известного ГАЗ-560, появятся на грузовичках и автобусах?

Дизелизация остается одной из приоритетных задач ОАО «ГАЗ». «Газель» не является исключением. Кроме лицензионных дизелей ГАЗ-560, 5601, уже проработана установка на этот автомобиль других двигателей: ИВЕКО, «Андория», «Тойота». Дизелями «Андория» сейчас оснащают «газели», собираемые в Литве. У нас в стране установкой этих двигателей занимается ряд специализированных фирм.

5. Почему на «Газель» не ставят гидроусилитель руля? Ведь «прописался» же он на более легком «Соболе»!

Завод выпускает автомобили «Газель» в различных комплектациях, в том числе с гидроусилителем руля от «Соболя» — можете приобрести любую. Возможна установка гидроусилителя от «Соболя» и на машину, не имевшую этой системы, но доверить это следует фирме (или сервису), имеющей лицензию на данный вид работ. «Самодеятельность» в этих вопросах запрещена.

Блок 11193 8 клапанов

Двигатель ВАЗ Калина 11193 — это малобюджетная версия, которая была разработана специально для автомобилей Лада нового поколения. Силовой агрегат 11193 показал себя достаточно хорошо в процессе эксплуатации. Так, многие автолюбители, которые хотят сэкономить на автомобиле, выбирают именно Ладу Калину.

Технические характеристики

Технические характеристики мотора ВАЗ 11193 мало чем отличаются от своего предшественника 1118. По сути, моторы можно назвать идентичными, но все-же различия существуют. Итак, рассмотрим, техническую характеристику силового агрегата.

Наименование Характеристика
Марка Лада
Модель 11193
Объем двигателя 1,6 литра (1596 см куб)
Мощность 102
Расположение Поперечно
Расход 9,6 литра на каждые 100 км пробега
Количество цилиндров 4
Количество клапанов 16
Диаметр поршня 82 мм
Охлаждение Жидкостное
Топливо Бензин (газ — как дополнительное оборудование)
Крутящий момент 137 Нм

Двигатель ВАЗ 11193 стал логическим продолжение для семейства Калины, а также он устанавливается на 10-е поколение транспортных средств Лада. Как видно, мотор является достаточно мощным и его хватает для такого небольшого автомобиля, как Калина. Если говорить о машинах 10-го поколения, то он достаточно слабоват.

Обслуживание мотора Калина 119

Техническое обслуживание для этого класса силовых агрегатов является однотипным. За рекомендацией завода изготовителя, проводить ТО необходимо каждые 15 000 км пробега. Но, как показывает практика, чем чаще и лучше проводить техническое обслуживание, тем большим будет ресурс. Так, установленный заводом АвтоВАЗ ресурс составляет 200 тыс. км, но если проводить обслуживание по следующей схеме, то двигатель ВАЗ 11193 может прослужить и все 300 000 км.

Итак, распишем, улучшенную схему обслуживания силового агрегата:

  • ТО-1: проводить после 5000 км пробега. При нем меняется масла и масляный фильтр. Также рекомендуется заменить топливный фильтрующий элемент. Это позволит топливной системе получать на начальном этапе эксплуатации более очищенное горючее, соответственно сберечь цилиндра и систему впрыска.
  • ТО-2: проводиться на 15000 км. Здесь необходимо заменить масло и фильтр, а также отрегулировать клапанный механизм.
  • ТО-3: 25000 км. Проведение этого технического обслуживания предусматривает стандартную замену масляного фильтра и смазки движка, а также меняется топливный и воздушный фильтр, прокладка клапанной крышки. В данном ТО также необходимо провести диагностику все датчиков и систем двигателя.
  • ТО-4: делается спустя 40 000 км пробега. Так, в данном случае, кроме замены стандартных элементов, таких как масло и фильтр, стоит заменить комплект газораспределительного механизм. Стоит отметить, что несвоевременная смена этого расходника может привести к худшим последствиям для мотора.

Последующие техническое обслуживание проводиться каждые 10-12 тыс. км по заданной схеме. Это сможет увеличить ресурс мотора на 50 000 — 60 000 км пробега, а если все нормально, то и на все 100 тыс. км.

Ремонт силового агрегата

Ремонтировать силовой агрегат ВАЗ 11193 достаточно просто, поскольку по конструктивным особенностям он мало чем отличается от 1118 и его модификаций. Единственным типовым конструктивным отличием является шестнадцати клапанная головка блока цилиндров и улучшенный вариант водяного насоса. Но, даже с этим может справиться не опытный автомобилист.

Как раннее указывалось, некоторые элементы двигателя стоит менять вовремя. Так, несвоевременная замена ремня ГРМ, может привести к согнутым клапанам, и еще более худших последствий. Таким образом, ремонтные операции стоит выполнять вовремя.

Инструкции по ремонту и диагностике можно найти в глобальной сети, или еще прощу найти книгу по ремонту и эксплуатации автомобилей семейства Лада Калина, которая выпущена заводом изготовителем. Здесь имеется вся необходимая информация для проведения ремонтных операций и обслуживания двигателя автомобиля.

Тюнинг и доработка

Доработка мотора ВАЗ 11193 проводиться достаточно легко. Так, процесс тюнинга делиться на два этапа, которые можно проводить вместе или по раздельности: программный и механический. Начнем с более распространенного варианта — электронного.

Пожалуй, почти каждый автолюбитель слышал о таком виде доработки, как чип тюнинг. Это прошивка бортового компьютера на выполнение определенных функций. Так, чип тюнинг бывает трех видов: стандартный, на мощность, на экономичность. В зависимости от того, что требуется автолюбителя, так и программируется ЭБУ.

Механический вариант доработки не распространенный, поскольку стоит достаточно дорого и отнимает много времени. Так, первое что дорабатывается — это поршневая группу. При этом происходит расточка стенок цилиндров под новые поршни, а сами элементы покупаются облегченные от производителя ATF. Также, на ряду с поршневой группой меняются и шатуны, а также вкладыши.

Вторым этапом доработки становится установка спортивных распределительных валов и замена клапанного механизма на более облегченный. Для шестнадцати клапанной Калины производитель DEF предлагает целый комплект улучшенных деталей, а именно: клапана, седла, направляющие втулки, распределительные валы и сальники.

Последним этапом становиться наружная доработка. В данном случае, проводится замена патрубков системы охлаждения (на силиконовые), смена водяного насоса, а также меняется генератор. Последней доработкой двигателя становится установка спортивного воздушного фильтра и дросселя. Все эти доработки позволят увеличить мощностные характеристики мотора и добавить до 50 лошадиных сил.

Вывод

Двигатель ВАЗ 11193 является продолжением полюбившегося силового агрегата 1118. Так, мотор показал себя с положительной стороны. Как показала практика, он достаточно простой в техническом обслуживании и ремонте, а ценовая политика на расходники — низкая, что позволяет этому мотору оставаться в бюджетной ценовой категории.

Также, с легкостью проводится поверхностный тюнинг, а вот если автолюбитель хочет большего, то придется обратиться к профессионалам.

Производитель: ОАО «АвтоВАЗ»

Блок цилиндров ВАЗ 11193 в сборе.
Применяется на двигателе ВАЗ 21124

Блок цилиндров 11193.

Обозначение — 11193-100201100.
Применяемость — двигатель ВАЗ 21124.
Блок цилиндров 11193 устанавливается на двигатели ВАЗ 21124. Эта модель — результат доработки блока 2112. Увеличенная высота (197,1мм) цилиндров позволила довести объем двигателя до 1.6 л.Блок 11193 сохранил особенности «2112-го»: крепежные отверстия для головки блока размером М10х1.25 и наличие специальных масляных форсунок для охлаждения поршней. Но на корпусе отсутствуют отверстия для датчика уровня масла. На корпусе имеется обозначение модели, надпись — «11193». Блок цилиндров 11193 окрашивается в серый цвет.
Вес — 31,000 кг. (без коленвала и поршней)

Блок цилиндров 21083 первоначально был сконструирован под параметры карбюраторного двигателя. Следовательно, в нем не предусматривалось наличия участков крепления элементов по аналогии с инжекторными двигателями, среди которых модуль зажигания, датчик детонации и т.д. Впоследствии происходит унификация отливки модели, вследствие чего она становится единой для блоков 21083, 2110 и 2112. Все они обладают одинаковой высотой и могут использоваться на двигателях, имеющих объем 1500 см куб. Потому корпус этих блоков имеет отметку «21083» на литье. В качестве запчасти с заводов сегодня отгружается изделие, имеющее номенклатурный номер 21083-100201100.

Корпус «83-го» обладает приливами, такими же, как на всех других блоках двигателей переднеприводных автомобилей Ваз. Однако резьбовые отверстия здесь имеются только на приливах, задействованных в установке оборудования. Унифицированный блок цилиндров для ВАЗ 21083 обладает и приливом для установки датчика уровня масла, который находится под масляным фильтром. Для того, чтобы закрепить головку блока на верхней плоскости присутствуют 10 отверстий формата М12х1.25. Цвет блока цилиндров 21083 – синий.

Унификация «083-го» привела к утрате блоком цилиндров ВАЗ 2110 своих характерных черт, связанных с дополнительными приливами на корпусе. Внешне он сегодня неотличим от «083-го». В БЦ 2110 так же используются три верхних резьбовых отверстия и три нижних отверстия части отливки для установки кронштейнов правой опоры двигателя илблои монтажа установочной планки генератора. Так как данное изделие монтируется на «инжекторные» двигатели, блок цилиндров имеет место для установки датчика детонации.

По аналогии с «083-м», здесь предполагается монтаж датчика уровня масла. Кроме того, блок цилиндров 2110 нередко используют для сборки двигателей ВАЗ 21083. Цвет блока 2110 – серый.

Блок цилиндров 2112 внешне неотличим от блоков 2110 и 21083, однако с ними он и взаимозаменяем. Главная его особенность — наличие крепежных отверстий для головки блока, размером М10х1.25. Кроме того, во второй, третьей, четвертой и пятой опорах коренных подшипников монтируются дополнительные каналы для масла со специальными запрессованными в них масляными форсунками. Именно через них в момент работы двигателя масло под давлением способно омывать днища поршней. Как следствие снижается их термическая деформация, улучшается смазка, что особенно важно в момент пуска двигателя. Ресурс последнего, таким образом, значительно увеличивается. Цвет цилиндров 2112 – серый.

Блок цилиндров 21114 фактически представляет собой модернизированную модель 2110. В ходе изменений объем двигателя увеличен до 1,6 литра. Именно поэтому блок стал «высоким» — 197,1мм. В остальном же БЦ 21114 практически не отличается от 2110. Главная особенность данного блока – отсутствие прилива и монтажного отверстия для датчика уровня масла под фильтром. Крепится головка блока на отверстия, имеющие резьбу М12х1.25. Масляные форсунки для охлаждения поршней на боке отсутствуют. Цвет блока 21114 – синий.

Сегодня АВТОВАЗ не выпускает блок цилиндров 21114, альтернативной моделью является БЦ 11183. Две эти модели фактически идентичны. Цвет блока цилиндров 11183 – серый.

Блок цилиндров 11193 предназначается для установки на двигатель ВАЗ 21124. Представляет собой доработанный и модернизированный блок 2112. Однако модель 11193 более высокая — 197,1мм, благодаря чему объем двигателя увеличен до 1.6 л.

Блок 11193 сконструирован на основе «2112-го». Имеет крепежные отверстия размером М10х1.25, предназначенные для установки головки блока. Так же здесь присутствуют и специализированные масляные форсунки, охлаждающие поршни. На корпусе блока надпись — «11193». Цвет изделия – серый.

Совместно с компанией Federal Mogul АвтоВАЗ разработал новый двигатель — ВАЗ 21126. При его создании основной задачей, стоявшей перед разработчиками, было соблюдение повышенных экологических норм, связанных с уменьшением токсичности выхлопных газов, а так же увеличение ресурса двигателя. В качестве основы конструкции использовался блок цилиндров 11193.

Блок цилиндров 21126 имеет высочайшее качество в обработки поверхности изделия, выполняющееся в соответствии с технологией Federal Mogul. В ходе этого процесса цилиндр подвергают плосковершинному хонингованию, что позволяет получить на его поверхности сетки микроканавок особого профиля. Именно он надежно удерживает смазку на поверхности изделия, снижая при этом потери энергии за счет трения. Таким образом, технология хонингования, которую применяют на АВТОВАЗЕ при обработке поверхности цилиндров блока ВАЗ 21126, отличается от предыдущих моделей.

Фирма Federal Mogul разработала основные технологические параметры хонингования поверхностей. Это и угол наклона, и его профиль, и частота нанесения микроканавок. При выполнении операции используется высококачественное оборудование фирмы Federal Mogul. Высокая точность изготовления позволяет определить три группы размеров цилиндров: A, B, C. Надежность работы двигателя повышается не только за счет новой технологии изготовления блока цилиндров, но и за счет нового поршневого комплекта, который представляет собой поршень+ палец+ кольца+ шатун. Цвет блока цилиндров 21126 – синий.

Блок цилиндров 11194 – это специализированная разработка для двигателей, имеющих объем 1,4 литра. В этой связи диаметр цилиндров был уменьшен до 76,5 мм. Однако по своей конструкции и наличию мест для крепления оборудования блок 11194 практически неотличим от моделей 11193 и 21126. Тем не менее, между смежными цилиндрами, благодаря уменьшению их диаметра, выполнены протоки рубашки охлаждения. Это позволило улучшить отвод тепла, повысить жесткость конструкции. Аналогичная обработка поверхности цилиндров в соответствии с технологией Federal Mogul осуществляется и на модели 21126. Цвет блока цилиндров ВАЗ 11194 – синий.

Двигатель ваз 11193 технические характеристики 8 клапанная.

Двигатель ВАЗ Калина 11193 — это малобюджетная версия, которая была разработана специально для автомобилей Лада нового поколения. Силовой агрегат 11193 показал себя достаточно хорошо в процессе эксплуатации. Так, многие автолюбители, которые хотят сэкономить на автомобиле, выбирают именно Ладу Калину.

Технические характеристики

Технические характеристики мотора ВАЗ 11193 мало чем отличаются от своего предшественника 1118. По сути, моторы можно назвать идентичными, но все-же различия существуют. Итак, рассмотрим, техническую характеристику силового агрегата.

Двигатель ВАЗ 11193 стал логическим продолжение для семейства Калины, а также он устанавливается на 10-е поколение транспортных средств Лада. Как видно, мотор является достаточно мощным и его хватает для такого небольшого автомобиля, как Калина. Если говорить о машинах 10-го поколения, то он достаточно слабоват.

Обслуживание мотора Калина 119

Техническое обслуживание для этого класса силовых агрегатов является однотипным. За рекомендацией завода изготовителя, проводить ТО необходимо каждые 15 000 км пробега. Но, как показывает практика, чем чаще и лучше проводить техническое обслуживание, тем большим будет ресурс. Так, установленный заводом АвтоВАЗ ресурс составляет 200 тыс. км, но если проводить обслуживание по следующей схеме, то двигатель ВАЗ 11193 может прослужить и все 300 000 км.

Итак, распишем, улучшенную схему обслуживания силового агрегата:

  • ТО-1: проводить после 5000 км пробега. При нем меняется масла и масляный фильтр. Также рекомендуется заменить топливный фильтрующий элемент. Это позволит топливной системе получать на начальном этапе эксплуатации более очищенное горючее, соответственно сберечь цилиндра и систему впрыска.
  • ТО-2: проводиться на 15000 км. Здесь необходимо заменить масло и фильтр, а также отрегулировать клапанный механизм.
  • ТО-3: 25000 км. Проведение этого технического обслуживания предусматривает стандартную замену масляного фильтра и смазки движка, а также меняется топливный и воздушный фильтр, прокладка клапанной крышки. В данном ТО также необходимо провести диагностику все датчиков и систем двигателя.
  • ТО-4: делается спустя 40 000 км пробега. Так, в данном случае, кроме замены стандартных элементов, таких как масло и фильтр, стоит заменить комплект газораспределительного механизм. Стоит отметить, что несвоевременная смена этого расходника может привести к худшим последствиям для мотора.

Последующие техническое обслуживание проводиться каждые 10-12 тыс. км по заданной схеме. Это сможет увеличить ресурс мотора на 50 000 — 60 000 км пробега, а если все нормально, то и на все 100 тыс. км.

Ремонт силового агрегата

Ремонтировать силовой агрегат ВАЗ 11193 достаточно просто, поскольку по конструктивным особенностям он мало чем отличается от 1118 и его модификаций. Единственным типовым конструктивным отличием является шестнадцати клапанная головка блока цилиндров и улучшенный вариант водяного насоса. Но, даже с этим может справиться не опытный автомобилист.

Как раннее указывалось, некоторые элементы двигателя стоит менять вовремя. Так, несвоевременная замена ремня ГРМ, может привести к согнутым клапанам, и еще более худших последствий. Таким образом, ремонтные операции стоит выполнять вовремя.

Инструкции по ремонту и диагностике можно найти в глобальной сети, или еще прощу найти книгу по ремонту и эксплуатации автомобилей семейства Лада Калина, которая выпущена заводом изготовителем. Здесь имеется вся необходимая информация для проведения ремонтных операций и обслуживания двигателя автомобиля.

Тюнинг и доработка

Доработка мотора ВАЗ 11193 проводиться достаточно легко. Так, процесс тюнинга делиться на два этапа, которые можно проводить вместе или по раздельности: программный и механический. Начнем с более распространенного варианта — электронного.

Пожалуй, почти каждый автолюбитель слышал о таком виде доработки, как чип тюнинг. Это прошивка бортового компьютера на выполнение определенных функций. Так, чип тюнинг бывает трех видов: стандартный, на мощность, на экономичность. В зависимости от того, что требуется автолюбителя, так и программируется ЭБУ.

Механический вариант доработки не распространенный, поскольку стоит достаточно дорого и отнимает много времени. Так, первое что дорабатывается — это поршневая группу. При этом происходит расточка стенок цилиндров под новые поршни, а сами элементы покупаются облегченные от производителя ATF. Также, на ряду с поршневой группой меняются и шатуны, а также вкладыши.

Вторым этапом доработки становится установка спортивных распределительных валов и замена клапанного механизма на более облегченный. Для шестнадцати клапанной Калины производитель DEF предлагает целый комплект улучшенных деталей, а именно: клапана, седла, направляющие втулки, распределительные валы и сальники.

Последним этапом становиться наружная доработка. В данном случае, проводится замена патрубков системы охлаждения (на силиконовые), смена водяного насоса, а также меняется генератор. Последней доработкой двигателя становится установка спортивного воздушного фильтра и дросселя. Все эти доработки позволят увеличить мощностные характеристики мотора и добавить до 50 лошадиных сил.

Вывод

Двигатель ВАЗ 11193 является продолжением полюбившегося силового агрегата 1118. Так, мотор показал себя с положительной стороны. Как показала практика, он достаточно простой в техническом обслуживании и ремонте, а ценовая политика на расходники — низкая, что позволяет этому мотору оставаться в бюджетной ценовой категории.

Также, с легкостью проводится поверхностный тюнинг, а вот если автолюбитель хочет большего, то придется обратиться к профессионалам.

Автомобиль «Лада-Калина» является бюджетной моделью российского завода «АвтоВАЗ». Под основным названием марки он не распространен в странах СНГ, там машина известна как Lada 1117, 1118, 1119. В широкое производство модели поступили в 2004 году, но в некоторых странах реализация началась не сразу, а спустя несколько лет.

Продажа является «родителем» данной модели) началась в 2008 году, только в Украине за два года было реализовано более 2 тысяч моделей.

Автомобиль оснащен двумя видами бензиновых двигателей. Разница между ними заключается в мощности — 81 и 89 лошадиных сил. Некоторые модификации имеют специальный привод и улучшенную коробку передач.

Дизайн

Мало кому покажется, что ВАЗ-1119 имеет скудный и неинтересный дизайн. Изначально автомобиль, благодаря стайлингу, стал привлекать к себе внимание покупателей. Кузов имеет весьма интересные формы, за счет этого внешность является динамичной и необыкновенной. Если более детально рассматривать машину, то она будет казаться мускулистой и крупной. Такой эффект достигается при помощи приподнятой передней части, высоких фар, необычного для этой линии бампера и специальных рельефных арок колес. Только глядя на внешний вид, можно сразу сказать, что автомобиль действительно надежный и комфортный. Производитель хорошо потрудился над созданием ВАЗ-1119.

Технические характеристики

Производство автомобиля началось в далеком 2004 году. Сборка осуществляется в Российской Федерации, а именно в Тольятти. Машина принадлежит к классу B. За счет этого «Калина» получила достаточно быстро много внимания от ценителей автопрома. Кузов установлен типа хэтчбек. Благодаря улучшенной конструкции машина отвечает всем современным требованиям и стандартам, которые связаны с безопасностью. В отличие от семейства «Самара», «Калина» (ВАЗ-1119) имеет большую маневренность и лучшую устойчивость на резких поворотах. На автомобиль в некоторых комплектациях предлагают несколько видов двигателей — 8 клапанов (1,6 л), 16 клапанов (1,4 л и 1,6 л). Все агрегаты имеют специальную систему электронного управления зажигания и вспрыскивания горючего. Бак для топлива способен вмещать 50 литров.

Комфортабельность

Тюнинг ВАЗ-1119 сделан с расчетом на пассажиров и водителя. Посадка в автомобиль достаточно комфортна за счет того, что установлены широкие двери, а проем имеет весьма впечатляющие габариты. Высота машины может удивить, даже высоким людям будет удобно сидеть в салоне. Сидения также отличаются повышенным уютом.

Производитель постарался сделать водительское место весьма эргономичным и подогнал его под европейские стандарты. В салоне установлены кресла с высокой посадкой, панель управления имеет логичный и понятный интерфейс. Система управления оснащена специальными кнопками для лучшей функциональности. Помимо этого, характеристика ВАЗ-1119 позволяет сказать о том, что салон выполнен в лучшем стиле. Имеются системы наблюдения за климатом.

Интерьер

В центральной консоли можно найти весьма удобный и вместительный ящик для вещей. Он может быть стандартным или улучшенным (в зависимости от комплектации). Бардачок также претерпел некоторые изменения: радует большим размером. приобрел откидной подстаканник, что является удобным для задних пассажиров. Основными цветами стали черный и серый оттенки.

На имеется ЖК-экран (что логично). Благодаря ему водитель автомобиля «Калина» (ВАЗ-1119) видит подсказки переключения передач.

Надежность и безопасность

Автомобиль соответствует всем российским и европейским требованиям по безопасности. Водителю предоставляется даже в самой бюджетной комплектации машины. В сборке «Норма» имеется усиленное экстренное торможение. Если водитель не пристегнулся то ВАЗ-1119 обязательно просигнализирует об этом.

В «Люксе» покупателю предоставляется стабилизатор устойчивости. При движении по сложной трассе система регулирует каждое колесо отдельн, чтобы поставить автомобиль в ровное положение. Кузов выполнен из материала с повышенной прочностью.

Техническая сторона автомобиля

Автомобиль способен поразить водителя, так как производитель добавил новый двигатель. ВАЗ-1119 может быть оборудован как автоматической, так и механической коробкой передач. Для любителей МКПП подойдет автомобиль, имеющий тросовый привод. Функция переключения сделана на уровне европейских автомобилей, система работает четко и без сбоев. АКПП, установленная на машине, имеет японские корни и поэтому отличается прекрасной работоспособностью. «Калина» двигается плавно и экономично. Однако при желании способна оставить позади себя весь городской поток.

Стандартная комплектация

В базовой комплектации потребитель получает двигатель 1,6 литра, агрегат рассчитан на 8 цилиндров. Помимо этого, машина обладает весьма приличными функциями. В частности она оснащена брусьями жесткости для дополнительной безопасности, системой регулирования ремней по высоте. В техническом сервисе имеется возможность перекрасить цвет бампера под гамму кузова, установить дополнительное колесо (которое идет в комплекте). В салоне из модификаций можно отметить раздельные задние сидения.

Комплектация «Норма»

Имеются все те функции, которые доступны в стандартной версии линии «Калина». Хэтчбек ВАЗ-1119 оснащен климатической системой, блокировкой тормозов, электроусилителем (которым можно управлять через панель приборов), подлокотниками и дополнительным комплектом дисков.

Двигатель объемом 1,4 литра. Агрегат имеет 16-клапанную систему. Он полностью отвечает всем стандартам Европы и Америки.

Комплектация «Люкс»

Автомобиль оснащен системами комплектации «Норма». Имеются подушки безопасности для водителя и еще одного переднего пассажира, система обогрева сидений, электростеклоподъемники, функция автоматического включения фар, стеклоочистители, которые сами срабатывают при сильном дожде. Обивка выполнена из бархата; фары имеют противотуманные диоды. Колесные диски выполнены из лития. Производитель установил и специальную функцию регулирования парковки. Установленный двигатель рассчитан на 1,6 литров.

Салон автомобиля

Наружные и регулируются при помощи рукоятки. Перед тем как начать движение, необходимо установить их таким образом, чтобы обзор был оптимальным.

Вне зависимости от того, включено зажигание или нет, прикуриватель работает. Для того чтобы он начал функционировать, его следует «утопить» в специальном отсеке. Через 20 секунд прикуриватель выпрыгнет горячим.

Козырьки, которые защищают от солнечных лучей, могут устанавливаться в трех разных положениях, как того пожелает пассажир или водитель.

Блок цилиндров 21083 первоначально был сконструирован под параметры карбюраторного двигателя. Следовательно, в нем не предусматривалось наличия участков крепления элементов по аналогии с инжекторными двигателями, среди которых модуль зажигания, датчик детонации и т.д. Впоследствии происходит унификация отливки модели, вследствие чего она становится единой для блоков 21083, 2110 и 2112. Все они обладают одинаковой высотой и могут использоваться на двигателях, имеющих объем 1500 см куб. Потому корпус этих блоков имеет отметку «21083» на литье. В качестве запчасти с заводов сегодня отгружается изделие, имеющее номенклатурный номер 21083-100201100.

Корпус «83-го» обладает приливами, такими же, как на всех других блоках двигателей переднеприводных автомобилей Ваз. Однако резьбовые отверстия здесь имеются только на приливах, задействованных в установке оборудования. Унифицированный для ВАЗ 21083 обладает и приливом для установки датчика уровня масла, который находится под масляным фильтром. Для того, чтобы закрепить головку блока на верхней плоскости присутствуют 10 отверстий формата М12х1.25. Цвет блока цилиндров 21083 — синий.

Унификация «083-го» привела к утрате блоком цилиндров ВАЗ 2110 своих характерных черт, связанных с дополнительными приливами на корпусе. Внешне он сегодня неотличим от «083-го». В БЦ 2110 так же используются три верхних резьбовых отверстия и три нижних отверстия части отливки для установки кронштейнов правой опоры двигателя илблои монтажа установочной планки генератора. Так как данное изделие монтируется на «инжекторные» двигатели, блок цилиндров имеет место для установки датчика детонации.

По аналогии с «083-м», здесь предполагается монтаж датчика уровня масла. Кроме того, блок цилиндров 2110 нередко используют для сборки двигателей ВАЗ 21083. Цвет блока 2110 — серый.

Блок цилиндров 2112 внешне неотличим от блоков 2110 и 21083, однако с ними он и взаимозаменяем. Главная его особенность — наличие крепежных отверстий для головки блока, размером М10х1.25. Кроме того, во второй, третьей, четвертой и пятой опорах коренных подшипников монтируются дополнительные каналы для масла со специальными запрессованными в них масляными форсунками. Именно через них в момент работы двигателя масло под давлением способно омывать днища поршней. Как следствие снижается их термическая деформация, улучшается смазка, что особенно важно в момент пуска двигателя. Ресурс последнего, таким образом, значительно увеличивается. Цвет цилиндров 2112 — серый.

Блок цилиндров 21114 фактически представляет собой модернизированную модель 2110. В ходе изменений объем двигателя увеличен до 1,6 литра. Именно поэтому блок стал «высоким» — 197,1мм. В остальном же БЦ 21114 практически не отличается от 2110. Главная особенность данного блока — отсутствие прилива и монтажного отверстия для датчика уровня масла под фильтром. Крепится головка блока на отверстия, имеющие резьбу М12х1.25. Масляные форсунки для охлаждения поршней на боке отсутствуют. Цвет блока 21114 — синий.

Сегодня АВТОВАЗ не выпускает блок цилиндров 21114, альтернативной моделью является БЦ 11183. Две эти модели фактически идентичны. Цвет блока цилиндров 11183 — серый.

Блок цилиндров 11193 предназначается для установки на двигатель ВАЗ 21124. Представляет собой доработанный и модернизированный блок 2112. Однако модель 11193 более высокая — 197,1мм, благодаря чему объем двигателя увеличен до 1.6 л.

Блок 11193 сконструирован на основе «2112-го». Имеет крепежные отверстия размером М10х1.25, предназначенные для установки головки блока. Так же здесь присутствуют и специализированные масляные форсунки, охлаждающие поршни. На корпусе блока надпись — «11193». Цвет изделия — серый.

Совместно с компанией Federal Mogul АвтоВАЗ разработал новый двигатель — ВАЗ 21126. При его создании основной задачей, стоявшей перед разработчиками, было соблюдение повышенных экологических норм, связанных с уменьшением токсичности выхлопных газов, а так же увеличение ресурса двигателя. В качестве основы конструкции использовался блок цилиндров 11193.

Блок цилиндров 21126 имеет высочайшее качество в обработки поверхности изделия, выполняющееся в соответствии с технологией Federal Mogul. В ходе этого процесса цилиндр подвергают плосковершинному хонингованию, что позволяет получить на его поверхности сетки микроканавок особого профиля. Именно он надежно удерживает смазку на поверхности изделия, снижая при этом потери энергии за счет трения. Таким образом, технология хонингования, которую применяют на АВТОВАЗЕ при обработке поверхности цилиндров блока ВАЗ 21126, отличается от предыдущих моделей.

Фирма Federal Mogul разработала основные технологические параметры хонингования поверхностей. Это и угол наклона, и его профиль, и частота нанесения микроканавок. При выполнении операции используется высококачественное оборудование фирмы Federal Mogul. Высокая точность изготовления позволяет определить три группы размеров цилиндров: A, B, C. Надежность работы двигателя повышается не только за счет новой технологии изготовления блока цилиндров, но и за счет нового поршневого комплекта, который представляет собой поршень+ палец+ кольца+ шатун. Цвет — синий.

Блок цилиндров 11194 — это специализированная разработка для двигателей, имеющих объем 1,4 литра. В этой связи диаметр цилиндров был уменьшен до 76,5 мм. Однако по своей конструкции и наличию мест для крепления оборудования блок 11194 практически неотличим от моделей 11193 и 21126. Тем не менее, между смежными цилиндрами, благодаря уменьшению их диаметра, выполнены протоки рубашки охлаждения. Это позволило улучшить отвод тепла, повысить жесткость конструкции. Аналогичная обработка поверхности цилиндров в соответствии с технологией Federal Mogul осуществляется и на модели 21126. Цвет блока цилиндров ВАЗ 11194 — синий.

На «Калину» я обратила внимание, когда подыскивала для себя подходящий вариант после того, как сдала на права. Мне нужна была компактная, надежная и недорогая машина чтобы спокойно закреплять навыки вождения. В то же время хотелось, чтобы машинка была симпатичная и изящная, я же все-таки девушка! По средствам особенно мне понравился автомобиль лада Калина с кузовом хэтчбек. Так как сама я ничего не смыслю ни в моторах, ни в кузовах, я призвала на помощь папу-бывалого пользователя авто и человека опытного во всех бытовых смыслах. Заранее в интернете я подобрала несколько объявлений, и на выходном мы устроили променад по адресам продавцов моей потенциальной лошадки в пределах родного города. Мы посмотрели несколько машин, но ничего не подошло: то отсутствовал усилитель руля, то цвет не очень, то хозяин подозрительный… Наконец нам попался хороший вариант, цвет понравился сразу, обтекаемая форма, симпатичный дизайн-все сразу приглянулось. Машина была 2012 года выпуска (покупала я ее в 2014 году). Единственный недостаток в том, что на лобовом стекле красовалась приличных масштабов трещина, а на бампере угадывались царапины. Но я как-то внутренне была готова смириться с этими недостатками, тем более хозяин нам уступил в цене. Машинке было немногим больше 2 лет, общее состояние хорошее. В общем, я решилась! Оформив все документы в один день, я окунулась в прелести водительских будней. Сначала было страшновато ездить по городу, но через пару дней я привыкла к машине и к дорожной обстановке… Я оценила плюсы небольшого размера кузова, ибо с парковкой вообще не было проблем!

Лобовое стекло удобного большого размера, обеспечивает превосходный обзор и даёт возможность лучше чувствовать габариты машины. Калина довольно мощная, 81,6 л.с. По городу и на трассе резвая, расход средний. Мы с мужем любители путешествий и горных пейзажей. Так вот, калина на горных дорогах (на асфальтированных, не на бездорожье!) показала себя достойно!


Учитывая наличие, помимо нас с мужем, двоих наших друзей и 4 рюкзака! Радует просторный салон. Водителю и пассажирам комфортно, ноги никуда не впиваются, хотя мы длинноногие))) Конечно багажник маловат, но чем-то приходится жертвовать! (((Ещё один немаловажный плюс Калины — высокий клиренс (расстояние между днищем авто и поверхностью дороги, дорожный просвет), позволяет преодолевать легкое бездорожье, а в городе — лежачих полицейских, даже если нечаянно не заметишь знак. Из минусов отмечу отсутствие кондиционера, хотя мы вполне справлялись с этим. Машина периодически требует вложений. За 4 года пользования (довольно активного!) мы успели поменять печку, лобовое стекло и бампер(требовали замены ещё при покупке), прошили авто, чтобы была порезвее, поменяли топливный насос, аккумулятор, купили чехлы и резиновые коврики в салон. Расходники (свечи, колодки, ремни, фильтры и масло строго по пробегу) я не считаю, ибо брали лучшее, следили тщательно. Чтобы не встрять где-нибудь на трассе. Тем не менее, машина пару раз глохла, правда в городе. Один раз сломался топливный насос, второй раз сдох аккумулятор, ещё раз перегорел предохранитель. Все равно считаю Калину прекрасным вариантом, оптимальным сочетанием цены и качества (кхе-кхе-кхе, насколько наши отечественные машины вообще могут быть качественными). Выглядит машинка стильно и приятно глазу. Так что рекомендую к приобретению!

Ваз 11193 технические характеристики

Автомобиль «Лада-Калина» является бюджетной моделью российского завода «АвтоВАЗ». Под основным названием марки он не распространен в странах СНГ, там машина известна как Lada 1117, 1118, 1119. В широкое производство модели поступили в 2004 году, но в некоторых странах реализация началась не сразу, а спустя несколько лет.

Продажа является «родителем» данной модели) началась в 2008 году, только в Украине за два года было реализовано более 2 тысяч моделей.

Автомобиль оснащен двумя видами бензиновых двигателей. Разница между ними заключается в мощности — 81 и 89 лошадиных сил. Некоторые модификации имеют специальный привод и улучшенную коробку передач.

Дизайн

Мало кому покажется, что ВАЗ-1119 имеет скудный и неинтересный дизайн. Изначально автомобиль, благодаря стайлингу, стал привлекать к себе внимание покупателей. Кузов имеет весьма интересные формы, за счет этого внешность является динамичной и необыкновенной. Если более детально рассматривать машину, то она будет казаться мускулистой и крупной. Такой эффект достигается при помощи приподнятой передней части, высоких фар, необычного для этой линии бампера и специальных рельефных арок колес. Только глядя на внешний вид, можно сразу сказать, что автомобиль действительно надежный и комфортный. Производитель хорошо потрудился над созданием ВАЗ-1119.

Технические характеристики

Производство автомобиля началось в далеком 2004 году. Сборка осуществляется в Российской Федерации, а именно в Тольятти. Машина принадлежит к классу B. За счет этого «Калина» получила достаточно быстро много внимания от ценителей автопрома. Кузов установлен типа хэтчбек. Благодаря улучшенной конструкции машина отвечает всем современным требованиям и стандартам, которые связаны с безопасностью. В отличие от семейства «Самара», «Калина» (ВАЗ-1119) имеет большую маневренность и лучшую устойчивость на резких поворотах. На автомобиль в некоторых комплектациях предлагают несколько видов двигателей — 8 клапанов (1,6 л), 16 клапанов (1,4 л и 1,6 л). Все агрегаты имеют специальную систему электронного управления зажигания и вспрыскивания горючего. Бак для топлива способен вмещать 50 литров.

Комфортабельность

Тюнинг ВАЗ-1119 сделан с расчетом на пассажиров и водителя. Посадка в автомобиль достаточно комфортна за счет того, что установлены широкие двери, а проем имеет весьма впечатляющие габариты. Высота машины может удивить, даже высоким людям будет удобно сидеть в салоне. Сидения также отличаются повышенным уютом.

Производитель постарался сделать водительское место весьма эргономичным и подогнал его под европейские стандарты. В салоне установлены кресла с высокой посадкой, панель управления имеет логичный и понятный интерфейс. Система управления оснащена специальными кнопками для лучшей функциональности. Помимо этого, характеристика ВАЗ-1119 позволяет сказать о том, что салон выполнен в лучшем стиле. Имеются системы наблюдения за климатом.

Интерьер

В центральной консоли можно найти весьма удобный и вместительный ящик для вещей. Он может быть стандартным или улучшенным (в зависимости от комплектации). Бардачок также претерпел некоторые изменения: радует большим размером. приобрел откидной подстаканник, что является удобным для задних пассажиров. Основными цветами стали черный и серый оттенки.

На имеется ЖК-экран (что логично). Благодаря ему водитель автомобиля «Калина» (ВАЗ-1119) видит подсказки переключения передач.

Надежность и безопасность

Автомобиль соответствует всем российским и европейским требованиям по безопасности. Водителю предоставляется даже в самой бюджетной комплектации машины. В сборке «Норма» имеется усиленное экстренное торможение. Если водитель не пристегнулся то ВАЗ-1119 обязательно просигнализирует об этом.

В «Люксе» покупателю предоставляется стабилизатор устойчивости. При движении по сложной трассе система регулирует каждое колесо отдельн, чтобы поставить автомобиль в ровное положение. Кузов выполнен из материала с повышенной прочностью.

Техническая сторона автомобиля

Автомобиль способен поразить водителя, так как производитель добавил новый двигатель. ВАЗ-1119 может быть оборудован как автоматической, так и механической коробкой передач. Для любителей МКПП подойдет автомобиль, имеющий тросовый привод. Функция переключения сделана на уровне европейских автомобилей, система работает четко и без сбоев. АКПП, установленная на машине, имеет японские корни и поэтому отличается прекрасной работоспособностью. «Калина» двигается плавно и экономично. Однако при желании способна оставить позади себя весь городской поток.

Стандартная комплектация

В базовой комплектации потребитель получает двигатель 1,6 литра, агрегат рассчитан на 8 цилиндров. Помимо этого, машина обладает весьма приличными функциями. В частности она оснащена брусьями жесткости для дополнительной безопасности, системой регулирования ремней по высоте. В техническом сервисе имеется возможность перекрасить цвет бампера под гамму кузова, установить дополнительное колесо (которое идет в комплекте). В салоне из модификаций можно отметить раздельные задние сидения.

Комплектация «Норма»

Имеются все те функции, которые доступны в стандартной версии линии «Калина». Хэтчбек ВАЗ-1119 оснащен климатической системой, блокировкой тормозов, электроусилителем (которым можно управлять через панель приборов), подлокотниками и дополнительным комплектом дисков.

Двигатель объемом 1,4 литра. Агрегат имеет 16-клапанную систему. Он полностью отвечает всем стандартам Европы и Америки.

Комплектация «Люкс»

Автомобиль оснащен системами комплектации «Норма». Имеются подушки безопасности для водителя и еще одного переднего пассажира, система обогрева сидений, электростеклоподъемники, функция автоматического включения фар, стеклоочистители, которые сами срабатывают при сильном дожде. Обивка выполнена из бархата; фары имеют противотуманные диоды. Колесные диски выполнены из лития. Производитель установил и специальную функцию регулирования парковки. Установленный двигатель рассчитан на 1,6 литров.

Салон автомобиля

Наружные и регулируются при помощи рукоятки. Перед тем как начать движение, необходимо установить их таким образом, чтобы обзор был оптимальным.

Вне зависимости от того, включено зажигание или нет, прикуриватель работает. Для того чтобы он начал функционировать, его следует «утопить» в специальном отсеке. Через 20 секунд прикуриватель выпрыгнет горячим.

Козырьки, которые защищают от солнечных лучей, могут устанавливаться в трех разных положениях, как того пожелает пассажир или водитель.

Блок цилиндров 21083 первоначально был сконструирован под параметры карбюраторного двигателя. Следовательно, в нем не предусматривалось наличия участков крепления элементов по аналогии с инжекторными двигателями, среди которых модуль зажигания, датчик детонации и т.д. Впоследствии происходит унификация отливки модели, вследствие чего она становится единой для блоков 21083, 2110 и 2112. Все они обладают одинаковой высотой и могут использоваться на двигателях, имеющих объем 1500 см куб. Потому корпус этих блоков имеет отметку «21083» на литье. В качестве запчасти с заводов сегодня отгружается изделие, имеющее номенклатурный номер 21083-100201100.

Корпус «83-го» обладает приливами, такими же, как на всех других блоках двигателей переднеприводных автомобилей Ваз. Однако резьбовые отверстия здесь имеются только на приливах, задействованных в установке оборудования. Унифицированный для ВАЗ 21083 обладает и приливом для установки датчика уровня масла, который находится под масляным фильтром. Для того, чтобы закрепить головку блока на верхней плоскости присутствуют 10 отверстий формата М12х1.25. Цвет блока цилиндров 21083 — синий.

Унификация «083-го» привела к утрате блоком цилиндров ВАЗ 2110 своих характерных черт, связанных с дополнительными приливами на корпусе. Внешне он сегодня неотличим от «083-го». В БЦ 2110 так же используются три верхних резьбовых отверстия и три нижних отверстия части отливки для установки кронштейнов правой опоры двигателя илблои монтажа установочной планки генератора. Так как данное изделие монтируется на «инжекторные» двигатели, блок цилиндров имеет место для установки датчика детонации.

По аналогии с «083-м», здесь предполагается монтаж датчика уровня масла. Кроме того, блок цилиндров 2110 нередко используют для сборки двигателей ВАЗ 21083. Цвет блока 2110 — серый.

Блок цилиндров 2112 внешне неотличим от блоков 2110 и 21083, однако с ними он и взаимозаменяем. Главная его особенность — наличие крепежных отверстий для головки блока, размером М10х1.25. Кроме того, во второй, третьей, четвертой и пятой опорах коренных подшипников монтируются дополнительные каналы для масла со специальными запрессованными в них масляными форсунками. Именно через них в момент работы двигателя масло под давлением способно омывать днища поршней. Как следствие снижается их термическая деформация, улучшается смазка, что особенно важно в момент пуска двигателя. Ресурс последнего, таким образом, значительно увеличивается. Цвет цилиндров 2112 — серый.

Блок цилиндров 21114 фактически представляет собой модернизированную модель 2110. В ходе изменений объем двигателя увеличен до 1,6 литра. Именно поэтому блок стал «высоким» — 197,1мм. В остальном же БЦ 21114 практически не отличается от 2110. Главная особенность данного блока — отсутствие прилива и монтажного отверстия для датчика уровня масла под фильтром. Крепится головка блока на отверстия, имеющие резьбу М12х1.25. Масляные форсунки для охлаждения поршней на боке отсутствуют. Цвет блока 21114 — синий.

Сегодня АВТОВАЗ не выпускает блок цилиндров 21114, альтернативной моделью является БЦ 11183. Две эти модели фактически идентичны. Цвет блока цилиндров 11183 — серый.

Блок цилиндров 11193 предназначается для установки на двигатель ВАЗ 21124. Представляет собой доработанный и модернизированный блок 2112. Однако модель 11193 более высокая — 197,1мм, благодаря чему объем двигателя увеличен до 1.6 л.

Блок 11193 сконструирован на основе «2112-го». Имеет крепежные отверстия размером М10х1.25, предназначенные для установки головки блока. Так же здесь присутствуют и специализированные масляные форсунки, охлаждающие поршни. На корпусе блока надпись — «11193». Цвет изделия — серый.

Совместно с компанией Federal Mogul АвтоВАЗ разработал новый двигатель — ВАЗ 21126. При его создании основной задачей, стоявшей перед разработчиками, было соблюдение повышенных экологических норм, связанных с уменьшением токсичности выхлопных газов, а так же увеличение ресурса двигателя. В качестве основы конструкции использовался блок цилиндров 11193.

Блок цилиндров 21126 имеет высочайшее качество в обработки поверхности изделия, выполняющееся в соответствии с технологией Federal Mogul. В ходе этого процесса цилиндр подвергают плосковершинному хонингованию, что позволяет получить на его поверхности сетки микроканавок особого профиля. Именно он надежно удерживает смазку на поверхности изделия, снижая при этом потери энергии за счет трения. Таким образом, технология хонингования, которую применяют на АВТОВАЗЕ при обработке поверхности цилиндров блока ВАЗ 21126, отличается от предыдущих моделей.

Фирма Federal Mogul разработала основные технологические параметры хонингования поверхностей. Это и угол наклона, и его профиль, и частота нанесения микроканавок. При выполнении операции используется высококачественное оборудование фирмы Federal Mogul. Высокая точность изготовления позволяет определить три группы размеров цилиндров: A, B, C. Надежность работы двигателя повышается не только за счет новой технологии изготовления блока цилиндров, но и за счет нового поршневого комплекта, который представляет собой поршень+ палец+ кольца+ шатун. Цвет — синий.

Блок цилиндров 11194 — это специализированная разработка для двигателей, имеющих объем 1,4 литра. В этой связи диаметр цилиндров был уменьшен до 76,5 мм. Однако по своей конструкции и наличию мест для крепления оборудования блок 11194 практически неотличим от моделей 11193 и 21126. Тем не менее, между смежными цилиндрами, благодаря уменьшению их диаметра, выполнены протоки рубашки охлаждения. Это позволило улучшить отвод тепла, повысить жесткость конструкции. Аналогичная обработка поверхности цилиндров в соответствии с технологией Federal Mogul осуществляется и на модели 21126. Цвет блока цилиндров ВАЗ 11194 — синий.

Двигатель ВАЗ Калина 11193 — это малобюджетная версия, которая была разработана специально для автомобилей Лада нового поколения. Силовой агрегат 11193 показал себя достаточно хорошо в процессе эксплуатации. Так, многие автолюбители, которые хотят сэкономить на автомобиле, выбирают именно Ладу Калину.

Технические характеристики

Технические характеристики мотора ВАЗ 11193 мало чем отличаются от своего предшественника 1118. По сути, моторы можно назвать идентичными, но все-же различия существуют. Итак, рассмотрим, техническую характеристику силового агрегата.

Двигатель ВАЗ 11193 стал логическим продолжение для семейства Калины, а также он устанавливается на 10-е поколение транспортных средств Лада. Как видно, мотор является достаточно мощным и его хватает для такого небольшого автомобиля, как Калина. Если говорить о машинах 10-го поколения, то он достаточно слабоват.

Обслуживание мотора Калина 119

Техническое обслуживание для этого класса силовых агрегатов является однотипным. За рекомендацией завода изготовителя, проводить ТО необходимо каждые 15 000 км пробега. Но, как показывает практика, чем чаще и лучше проводить техническое обслуживание, тем большим будет ресурс. Так, установленный заводом АвтоВАЗ ресурс составляет 200 тыс. км, но если проводить обслуживание по следующей схеме, то двигатель ВАЗ 11193 может прослужить и все 300 000 км.

Итак, распишем, улучшенную схему обслуживания силового агрегата:

  • ТО-1: проводить после 5000 км пробега. При нем меняется масла и масляный фильтр. Также рекомендуется заменить топливный фильтрующий элемент. Это позволит топливной системе получать на начальном этапе эксплуатации более очищенное горючее, соответственно сберечь цилиндра и систему впрыска.
  • ТО-2: проводиться на 15000 км. Здесь необходимо заменить масло и фильтр, а также отрегулировать клапанный механизм.
  • ТО-3: 25000 км. Проведение этого технического обслуживания предусматривает стандартную замену масляного фильтра и смазки движка, а также меняется топливный и воздушный фильтр, прокладка клапанной крышки. В данном ТО также необходимо провести диагностику все датчиков и систем двигателя.
  • ТО-4: делается спустя 40 000 км пробега. Так, в данном случае, кроме замены стандартных элементов, таких как масло и фильтр, стоит заменить комплект газораспределительного механизм. Стоит отметить, что несвоевременная смена этого расходника может привести к худшим последствиям для мотора.

Последующие техническое обслуживание проводиться каждые 10-12 тыс. км по заданной схеме. Это сможет увеличить ресурс мотора на 50 000 — 60 000 км пробега, а если все нормально, то и на все 100 тыс. км.

Ремонт силового агрегата

Ремонтировать силовой агрегат ВАЗ 11193 достаточно просто, поскольку по конструктивным особенностям он мало чем отличается от 1118 и его модификаций. Единственным типовым конструктивным отличием является шестнадцати клапанная головка блока цилиндров и улучшенный вариант водяного насоса. Но, даже с этим может справиться не опытный автомобилист.

Как раннее указывалось, некоторые элементы двигателя стоит менять вовремя. Так, несвоевременная замена ремня ГРМ, может привести к согнутым клапанам, и еще более худших последствий. Таким образом, ремонтные операции стоит выполнять вовремя.

Инструкции по ремонту и диагностике можно найти в глобальной сети, или еще прощу найти книгу по ремонту и эксплуатации автомобилей семейства Лада Калина, которая выпущена заводом изготовителем. Здесь имеется вся необходимая информация для проведения ремонтных операций и обслуживания двигателя автомобиля.

Тюнинг и доработка

Доработка мотора ВАЗ 11193 проводиться достаточно легко. Так, процесс тюнинга делиться на два этапа, которые можно проводить вместе или по раздельности: программный и механический. Начнем с более распространенного варианта — электронного.

Пожалуй, почти каждый автолюбитель слышал о таком виде доработки, как чип тюнинг. Это прошивка бортового компьютера на выполнение определенных функций. Так, чип тюнинг бывает трех видов: стандартный, на мощность, на экономичность. В зависимости от того, что требуется автолюбителя, так и программируется ЭБУ.

Механический вариант доработки не распространенный, поскольку стоит достаточно дорого и отнимает много времени. Так, первое что дорабатывается — это поршневая группу. При этом происходит расточка стенок цилиндров под новые поршни, а сами элементы покупаются облегченные от производителя ATF. Также, на ряду с поршневой группой меняются и шатуны, а также вкладыши.

Вторым этапом доработки становится установка спортивных распределительных валов и замена клапанного механизма на более облегченный. Для шестнадцати клапанной Калины производитель DEF предлагает целый комплект улучшенных деталей, а именно: клапана, седла, направляющие втулки, распределительные валы и сальники.

Последним этапом становиться наружная доработка. В данном случае, проводится замена патрубков системы охлаждения (на силиконовые), смена водяного насоса, а также меняется генератор. Последней доработкой двигателя становится установка спортивного воздушного фильтра и дросселя. Все эти доработки позволят увеличить мощностные характеристики мотора и добавить до 50 лошадиных сил.

Вывод

Двигатель ВАЗ 11193 является продолжением полюбившегося силового агрегата 1118. Так, мотор показал себя с положительной стороны. Как показала практика, он достаточно простой в техническом обслуживании и ремонте, а ценовая политика на расходники — низкая, что позволяет этому мотору оставаться в бюджетной ценовой категории.

Также, с легкостью проводится поверхностный тюнинг, а вот если автолюбитель хочет большего, то придется обратиться к профессионалам.

На «Калину» я обратила внимание, когда подыскивала для себя подходящий вариант после того, как сдала на права. Мне нужна была компактная, надежная и недорогая машина чтобы спокойно закреплять навыки вождения. В то же время хотелось, чтобы машинка была симпатичная и изящная, я же все-таки девушка! По средствам особенно мне понравился автомобиль лада Калина с кузовом хэтчбек. Так как сама я ничего не смыслю ни в моторах, ни в кузовах, я призвала на помощь папу-бывалого пользователя авто и человека опытного во всех бытовых смыслах. Заранее в интернете я подобрала несколько объявлений, и на выходном мы устроили променад по адресам продавцов моей потенциальной лошадки в пределах родного города. Мы посмотрели несколько машин, но ничего не подошло: то отсутствовал усилитель руля, то цвет не очень, то хозяин подозрительный… Наконец нам попался хороший вариант, цвет понравился сразу, обтекаемая форма, симпатичный дизайн-все сразу приглянулось. Машина была 2012 года выпуска (покупала я ее в 2014 году). Единственный недостаток в том, что на лобовом стекле красовалась приличных масштабов трещина, а на бампере угадывались царапины. Но я как-то внутренне была готова смириться с этими недостатками, тем более хозяин нам уступил в цене. Машинке было немногим больше 2 лет, общее состояние хорошее. В общем, я решилась! Оформив все документы в один день, я окунулась в прелести водительских будней. Сначала было страшновато ездить по городу, но через пару дней я привыкла к машине и к дорожной обстановке… Я оценила плюсы небольшого размера кузова, ибо с парковкой вообще не было проблем!

Лобовое стекло удобного большого размера, обеспечивает превосходный обзор и даёт возможность лучше чувствовать габариты машины. Калина довольно мощная, 81,6 л.с. По городу и на трассе резвая, расход средний. Мы с мужем любители путешествий и горных пейзажей. Так вот, калина на горных дорогах (на асфальтированных, не на бездорожье!) показала себя достойно!


Учитывая наличие, помимо нас с мужем, двоих наших друзей и 4 рюкзака! Радует просторный салон. Водителю и пассажирам комфортно, ноги никуда не впиваются, хотя мы длинноногие))) Конечно багажник маловат, но чем-то приходится жертвовать! (((Ещё один немаловажный плюс Калины — высокий клиренс (расстояние между днищем авто и поверхностью дороги, дорожный просвет), позволяет преодолевать легкое бездорожье, а в городе — лежачих полицейских, даже если нечаянно не заметишь знак. Из минусов отмечу отсутствие кондиционера, хотя мы вполне справлялись с этим. Машина периодически требует вложений. За 4 года пользования (довольно активного!) мы успели поменять печку, лобовое стекло и бампер(требовали замены ещё при покупке), прошили авто, чтобы была порезвее, поменяли топливный насос, аккумулятор, купили чехлы и резиновые коврики в салон. Расходники (свечи, колодки, ремни, фильтры и масло строго по пробегу) я не считаю, ибо брали лучшее, следили тщательно. Чтобы не встрять где-нибудь на трассе. Тем не менее, машина пару раз глохла, правда в городе. Один раз сломался топливный насос, второй раз сдох аккумулятор, ещё раз перегорел предохранитель. Все равно считаю Калину прекрасным вариантом, оптимальным сочетанием цены и качества (кхе-кхе-кхе, насколько наши отечественные машины вообще могут быть качественными). Выглядит машинка стильно и приятно глазу. Так что рекомендую к приобретению!

Технические характеристики двигателя ВАЗ 11193

. Техническая сторона автомобиля

Блок цилиндров 21083 изначально проектировался под параметры карбюраторного двигателя. Следовательно, не предусматривалось наличие секций для крепления элементов по аналогии с инжекторными двигателями, включая модуль зажигания, датчик детонации и т. Д. В дальнейшем отливка модели унифицируется, в результате чего она становится такой же. для блоков 21083, 2110 и 2112. Все они имеют одинаковую высоту и могут использоваться на двигателях объемом 1500 см3.Поэтому на отливке корпус этих блоков имеет маркировку «21083». В качестве запасной части сегодня с заводов отгружается товар с номенклатурным номером 21083-100201100.

Кузов «83-го» имеет приливы, как и на всех остальных блоках двигателей переднеприводных автомобилей ВАЗ. Однако резьбовые отверстия присутствуют только на проушинах, используемых при установке оборудования. Стандартизированный для ВАЗ 21083 также есть прилив для установки датчика уровня масла, который находится под масляным фильтром.Для фиксации головки блока на верхней плоскости предусмотрено 10 отверстий формата M12x1,25. Цвет блока цилиндров 21083 синий.

Унификация «083-го» привела к потере блоком цилиндров ВАЗ 2110 его характерных особенностей, связанных с дополнительными приливами на кузове. Внешне сегодня он неотличим от «083-го». В BC 2110 три верхних резьбовых отверстия и три нижних отверстия литой детали также используются для установки кронштейнов правой опоры двигателя или для установки монтажной пластины генератора.Поскольку этот продукт устанавливается на «инжекторные» двигатели, в блоке цилиндров есть место для установки датчика детонации.

По аналогии с «083» здесь предполагается установка датчика уровня масла. Кроме того, блок цилиндров 2110 часто используется для сборки двигателей ВАЗ 21083. Цвет блока 2110 серый.

Блок цилиндров 2112 внешне неотличим от блоков 2110 и 21083, однако он взаимозаменяем с ними. Его главная особенность — наличие отверстий для крепления головки блока размером M10x1.25. Кроме того, во втором, третьем, четвертом и пятом подшипниках коренных подшипников установлены дополнительные масляные каналы с запрессованными в них специальными масляными форсунками. Именно через них во время работы двигателя масло под давлением способно омывать головки поршней. В результате уменьшается их термическая деформация, улучшается смазка, что особенно важно в момент запуска двигателя. Таким образом, ресурс последнего значительно увеличивается. Цвет цилиндров 2112 серый.

Блок цилиндров 21114 по сути это модернизированная модель 2110. В ходе изменений объем двигателя был увеличен до 1,6 л. Поэтому блок стал «высоким» — 197,1 мм. В остальном BC 21114 практически ничем не отличается от 2110. Главная особенность данного агрегата — отсутствие прилива и отверстия для крепления датчика уровня масла под фильтром. Головка блока крепится к отверстиям резьбой М12х1,25. Масляных форсунок для охлаждения поршней сбоку нет.Цвет блока 21114 синий.

Сегодня АВТОВАЗ не производит блок цилиндров 21114, альтернативная модель — ВС 11183. Эти две модели практически идентичны. Цвет блока цилиндров 11183 серый.

Блок цилиндров 11193 предназначен для установки на двигатель ВАЗ 21124. Это доработанный и модернизированный блок 2112. Однако модель 11193 выше — 197,1 мм, за счет чего объем двигателя увеличен до 1,6 л.

Блок 11193 разработан на базе «2112».Имеет крепежные отверстия M10x1,25 для крепления головки блока. Также существуют специализированные масляные форсунки, охлаждающие поршни. На корпусе блока надпись — «11193». Цвет изделия — серый.

Совместно с Federal Mogul АвтоВАЗ разработал новый двигатель — ВАЗ 21126. При его создании основной задачей, стоявшей перед разработчиками, было соблюдение повышенных экологических норм, связанных со снижением токсичности выхлопных газов, а также увеличением ресурса двигателя. За основу конструкции был взят блок цилиндров 11193.

Блок цилиндров 21126 имеет высочайшее качество обработки поверхности изделия, выполненной по технологии Federal Mogul. В ходе этого процесса цилиндр подвергается плоскому хонингованию, что позволяет получить на его поверхности сетку микроканавок особого профиля. Именно он надежно удерживает смазку на поверхности изделия, снижая при этом потери энергии из-за трения. Таким образом, применяемая на АВТОВАЗе технология хонингования при обработке поверхности цилиндров блока ВАЗ 21126 отличается от предыдущих моделей.

Federal Mogul разработала основные технологические параметры для поверхностного хонингования. Это и угол наклона, и его профиль, и частота нанесения микроканавок. При эксплуатации используется качественное оборудование от Federal Mogul. Высокая точность изготовления позволяет определить три группы размеров цилиндров: A, B, C. Надежность двигателя повышена не только за счет новой технологии изготовления блока цилиндров, но и за счет нового поршневого набора, который поршень + палец + кольца + шатун.Цвет синий.

Блок цилиндров 11194 — это специализированная разработка для двигателей объемом 1,4 л. В связи с этим диаметр цилиндра был уменьшен до 76,5 мм. Однако блок 11194 практически ничем не отличается от моделей 11193 и 21126 по конструкции и наличию мест для крепления оборудования. Тем не менее, между соседними цилиндрами делают каналы рубашки охлаждения из-за уменьшения их диаметра. Это позволило улучшить отвод тепла и повысить жесткость конструкции.Аналогичная обработка поверхности цилиндров по технологии Federal Mogul проводится на модели 21126. Цвет блока цилиндров ВАЗ 11194 — синий.

Элегант Калина

ВАЗ 1119 — первое поколение модели, выпускавшееся с 2006 по 2013 год. Объем багажника автомобиля составляет 235 литров. За счет высокого открывания и возможности быстро складывать заднее сиденье Калина ВАЗ 11193 способна перевозить негабаритные грузы.

Комплектация хетчбэк представлена ​​в 3-х вариантах.

  1. Стандарт.
  2. Норм.
  3. Люкс.

К достоинствам верхней и средней версии можно отнести наличие АБС, передних подушек безопасности и системы кондиционирования с соответствующей сплит-системой. Комплектация «Люкс» Lada Kalina 111930 предусматривает улучшенную обивку салона и дверные панели. Салон машины просторный и удобный. При необходимости его можно настроить.

Характеристики светотехники и современный внешний вид ВАЗ 1119 способствуют увеличению спроса на данную модель.Купить можно у официальных дилеров ВАЗа. Каталог ознакомит всех с техническими возможностями автомобиля, цветовыми решениями кузова и другими деталями, которые необходимо учитывать при покупке транспортного средства.

Цены на каждую модель рассчитываются индивидуально. Владельцы автомобилей Лада Калина 1119 оставляют положительные отзывы о своем автомобиле. Этот экономичный автомобиль отлично подходит как для езды по городу, так и для поездок на дальние расстояния.

Доработка и тюнинг хэтчбека

ВАЗ 1119 — переднеприводный хэтчбек класса В.Обновлен внешний вид модели. Разработчики добавили четкие грани и прямые линии, изменили решетку радиатора. Головная оптика и ПТФ претерпели некоторые изменения.

Калина салон

Также коснулась модернизации ВАЗ 1119. Новая приборная панель, удобное рулевое колесо в практичном и комфортабельном салоне приятно удивят каждого водителя. Изменился профиль передних сидений, а диапазон продольной регулировки каждого сиденья увеличен на 20 мм.Водители невысокого роста находят этот автомобиль более комфортным в управлении, чем модель первого поколения.

Ходовая часть Калины аналогична Гранте. Автомобиль имеет увеличенный картер, заднюю балку с отрицательным развалом, короткую рулевую рейку, амортизаторы, рессоры, сайлентблоки. Качество рулевого управления ВАЗ 1119 повысилось за счет жесткого крепления рейки.

Под капотом Калины находится бензиновый двигатель объемом 1,6 л с 8 клапанами и мощностью 87 л.с. В этом случае крутящий момент составляет 140 Нм. Если доработать силовой агрегат, установив облегченный шатунно-поршневой механизм, мощность двигателя увеличится до 98 л. с. С таким двигателем может работать автоматическая трансмиссия. На ВАЗ 1119 устанавливается МКПП с настроенной системой впуска, увеличивающей мощность двигателя до 106 л.с. с., а крутящий момент — до 148 Нм.

Двигатель, оснащенный электронным зажиганием и впрыском топлива, отвечает самым строгим требованиям по контролю за выбросами.Данная модель соответствует всем требованиям по экологии и безопасности. Прочность и неприхотливость в эксплуатации — главные достоинства ВАЗ 11193.

Модернизированная конструкция двигателя отличается стальным впускным коллектором и прокладками головки блока цилиндров. Поэтому 1,4-литровый двигатель намного экономичнее и легче 1,6-литрового двигателя. Автомобиль с 8-клапанным двигателем потребляет 7,8 л бензина на 100 км пути. Мотор с 16 клапанами — всего 7 литров на 100 км.

Современный дизайн двигателя придает ВАЗ 1119 еще большую динамичность.Пик крутящего момента двигателя 1400 куб. См происходит при 4200 об / мин. Для аналога 1600 куб.см этот показатель достигается при 2500 об / мин.

Обратил внимание на Калину, когда искал себе подходящий вариант после того, как сдал на лицензию. Мне нужна была компактная, надежная и недорогая машина, чтобы спокойно закрепить навыки вождения. При этом хотелось, чтобы машина была красивой и грациозной, я еще девушка! Кстати, мне особенно понравилась машина Лада Калина с кузовом хэтчбек. Так как я сам ничего не разбираюсь ни в моторах, ни в кузовах, то обратился за помощью к своему папе, опытному автомобилестроителю и опытному человеку во всех бытовых смыслах.Заранее в Интернете я подобрал несколько объявлений, а на выходных мы устроили прогулку по адресам продавцов моей потенциальной лошади в моем родном городе. Посмотрели несколько машин, но ничего не подошло: либо нет гидроусилителя, либо цвет был не очень, либо хозяин был подозрительным … Наконец-то нам попался хороший вариант, цвет нам сразу понравился, обтекаемая форма, приятный дизайн — все понравилось сразу. Автомобиль 2012 года выпуска (купил в 2014 году).Единственным недостатком было то, что на лобовом стекле была трещина приличного масштаба, а на бампере угадывались царапины. Но как-то внутренне я был готов смириться с этими недостатками, тем более что хозяин проиграл нам в цене. Машине было чуть больше 2-х лет, общее состояние хорошее. В общем, решился! Оформив все документы за один день, я погрузился в прелести водительских будней. Поначалу было страшно ездить по городу, но через пару дней я привык и к машине, и к дорожной ситуации… Оценил преимущества небольшого размера кузова, потому что вообще не было проблем с парковкой!

Лобовое стекло большое и удобное, обеспечивая отличный обзор и лучшее представление о размерах машины. Калина довольно мощная, 81,6 л.с. В городе и по трассе резвая, расход средний. Мы с мужем — любители путешествий и горных пейзажей. Итак, калина на горных дорогах (по асфальту, а не по бездорожью!) Себя зарекомендовала!


Учитывая наличие, помимо нас с мужем, двух наших друзей и 4 рюкзака! Порадовал просторный салон.Водителю и пассажирам комфортно, ноги нигде не кусаются, хотя у нас длинноногие))) Багажник конечно маловат, но надо чем-то жертвовать! (((Еще один немаловажный плюс Калины — высокий клиренс (расстояние между днищем автомобиля и дорожным покрытием, клиренс)), позволяет преодолевать легкое бездорожье, а в городе — лежачие полицейские, даже если случайно не замечаете вывеску.Мы неплохо с ней справились.Автомобиль периодически требует вложений.За 4 года использования (довольно активно!) Успели поменять печку, лобовое стекло и бампер (их нужно было менять даже при покупке), попросили машину быть быстрее, поменяли бензонасос, аккумулятор, купили чехлы и резину коврики. Расходники (свечи, колодки, ремни, фильтры и масло строго по пробегу) не думаю, т.к. брал самые лучшие, смотрел внимательно. Чтобы не застрять где-нибудь на трассе. Тем не менее машина пару раз глухая, хоть и по городу. Как только бензонасос сломался, аккумулятор умер второй раз, предохранитель снова перегорел.Я до сих пор считаю Калину отличным вариантом, лучшим сочетанием цены и качества (до кашля-кашля, какими качественными в целом могут быть наши отечественные автомобили). Машинка выглядит стильно и приятно глазу. Так что рекомендую к покупке!

Автомобиль Лада-Калина — бюджетная модель российского завода АвтоВАЗ. Под основным брендом он не получил широкого распространения в странах СНГ, где автомобиль известен как Lada 1117, 1118, 1119. В массовое производство модели поступили в 2004 году, но в некоторых странах реализация началась не сразу, а через несколько лет. потом.

Продажа «материнской» этой модели) началась в 2008 году, только в Украине за два года было продано более 2 тысяч моделей.

Автомобиль комплектуется двумя типами бензиновых двигателей. Разница между ними заключается в мощности — 81 и 89 лошадиных сил. Некоторые модификации имеют особый привод и улучшенную коробку передач.

Конструкция

Мало кто думает, что ВАЗ-1119 имеет скудный и неинтересный дизайн. Изначально машина благодаря стайлингу стала привлекать внимание покупателей.Кузов имеет очень интересные формы, за счет этого внешний вид получается динамичным и неординарным. Если присмотреться к машине, то она покажется мускулистой и большой. Такой эффект достигается за счет приподнятого передка, высоких фар, необычного для этой линии бампера и специальных рельефных колесных арок. Просто взглянув на внешний вид, можно сразу сказать, что автомобиль действительно надежный и комфортный. Производитель хорошо поработал над созданием ВАЗ-1119.

Технические характеристики

Производство автомобилей началось еще в 2004 году.Сборка осуществляется в РФ, а именно в Тольятти. Автомобиль относится к классу Б. Благодаря этому «Калина» быстро получила большое внимание ценителей автомобилестроения. Кузов устанавливается как хэтчбек. Благодаря усовершенствованной конструкции машина соответствует всем современным требованиям и стандартам, связанным с безопасностью. В отличие от семейства Samara, Kalina (ВАЗ-1119) обладает большей маневренностью и лучшей устойчивостью на крутых поворотах. Для автомобиля предлагается несколько типов двигателей в некоторых комплектациях — 8 клапанов (1.6 литров), 16 клапанов (1,4 литра и 1,6 литра). Все агрегаты имеют специальную электронную систему управления зажиганием и впрыском топлива. Топливный бак вмещает 50 литров.

Комфорт

Тюнинг ВАЗ-1119 производится с расчетом на пассажиров и водителя. Садиться в машину достаточно комфортно за счет того, что установлены широкие двери, а проем имеет весьма внушительные размеры. Высота автомобиля может удивить, даже высоким людям будет комфортно сидеть в салоне.Сиденья тоже более удобные.

Производитель постарался сделать водительское кресло максимально эргономичным и подогнал его под европейские стандарты. Кабина оборудована высокими сиденьями, панель управления имеет логичный и интуитивно понятный интерфейс. Система управления оснащена специальными кнопками для большей функциональности. Кроме того, характеристики ВАЗ-1119 позволяют говорить о том, что интерьер выполнен в лучшем стиле. Есть системы мониторинга климата.

Интерьер

В центральной консоли вы найдете очень удобный и вместительный ящик для хранения вещей.Он может быть стандартным или улучшенным (в зависимости от комплектации). Бардачок тоже претерпел некоторые изменения: он радует большими размерами. приобрел складывающийся подстаканник, удобный для задних пассажиров. Основные цвета — черный и серый.

Имеет жидкокристаллический экран (что логично). Благодаря ему водитель автомобиля Калина (ВАЗ-1119) видит подсказки по переключению передач.

Надежность и безопасность

Автомобиль соответствует всем российским и европейским требованиям безопасности.Водитель предусмотрен даже в самой бюджетной комплектации автомобиля. В агрегате «Норма» усилено экстренное торможение. Если водитель не пристегнул ремень безопасности, то ВАЗ-1119 обязательно сигнализирует об этом.

В «Люкс» покупателю предоставляется стабилизатор устойчивости. При движении по труднопроходимой местности система регулирует каждое колесо индивидуально, чтобы автомобиль оставался ровным. Корпус выполнен из материала повышенной прочности.

Техническая сторона автомобиля

Автомобиль способен впечатлить водителя, поскольку производитель добавил новый двигатель.ВАЗ-1119 может оснащаться как автоматической, так и механической трансмиссией. Для любителей механической трансмиссии подойдет автомобиль с тросовым приводом. Функция переключения сделана на уровне европейских автомобилей, система работает плавно и без перебоев. Установленная на автомобиль автоматическая трансмиссия имеет японские корни и поэтому имеет отличные характеристики. Калина едет плавно и экономично. Однако при желании он способен оставить позади весь городской поток.

Стандартная комплектация

В базовой конфигурации потребитель получает 1.Двигатель 6 литров, агрегат рассчитан на 8 цилиндров. Кроме того, у машины есть довольно приличные характеристики. В частности, он оснащен планками жесткости для дополнительной безопасности, системой регулировки высоты ремня. В техническом сервисе есть возможность перекрасить бампер в цвет под масштаб кузова, установить дополнительный руль (который входит в комплект). В салоне из доработок можно отметить раздельные задние сиденья.

Доработка «Норма»

Есть все те функции, которые есть в стандартной версии линейки Калина.Хэтчбек ВАЗ-1119 оснащен климатической системой, блокировкой тормозов, электроусилителем (управление которым осуществляется через панель приборов), подлокотниками и дополнительным комплектом дисков.

Двигатель 1,4 л. Агрегат имеет 16-клапанную систему. Он полностью соответствует всем стандартам Европы и Америки.

Комплектация «Люкс»

Машина оборудована системой подбора «Норма». Есть подушки безопасности для водителя и еще одного переднего пассажира, система обогрева сидений, электрические стеклоподъемники, автоматические фары, дворники, которые работают самостоятельно в сильный дождь.Обивка — бархат; в фарах есть противотуманные диоды. Колесные диски сделаны из лития. Производитель также установил специальную функцию контроля парковки. Установленный двигатель рассчитан на 1,6 л.

Интерьер автомобиля

Внешний регулируемый с помощью ручки. Перед тем, как начать движение, нужно настроить их таким образом, чтобы видимость была оптимальной.

Вне зависимости от того, включено зажигание или нет, прикуриватель работает. Чтобы он заработал, его нужно «утопить» в специальном отсеке.Через 20 секунд прикуриватель выскочит горячим.

Солнцезащитные козырьки могут быть установлены в трех различных положениях по желанию пассажира или водителя.

JMSE | Бесплатный полнотекстовый | Обвалы валунов позднего плейстоцена, эродированные с базальтового побережья на пляже Эль-Конфиталь на Гран-Канарии (Канарские острова, Испания)

Исходя из исходных данных (Таблица A1, Таблица A2, Таблица A3, Таблица A4, Таблица A5 и Таблица A6), размер обломков составляет наилучшим образом нанесены на гистограммы как функция частоты в зависимости от максимальной и промежуточной длин двух самых длинных осей, перпендикулярных друг другу.На дюжине построенных графиков (рис. 4a – l) показаны тенденции изменения размера обломков, отсортированные по интервалам 15 см, в которых граница между булыжниками и валунами проходит в пределах диапазона обломков диаметром от 16 до 30 см. В левом столбце (рис. 4a, c, e, g, k) показаны латеральные вариации максимальной длины валуна для шести образцов на разрезе с востока на запад вдоль палеобережья верхнего плейстоцена. В целом, в каждом из образцов в этом измерении численно преобладают валуны в отличие от булыжников в соотношении от 3: 2 до 4: 1.Образцы с восточного конца (рис. 4a, c) отражают различия, соответствующие нормальной колоколообразной кривой, тогда как образцы с западного конца (рис. 4i, k) сильно перекошены и включают несколько валунов экстремального размера, превышающего один метр. Напротив, правая колонка (рис. 5b, d, f, h, j, l) показывает латеральные вариации значений промежуточной длины обломков. Во всех примерах, кроме двух (рис. 4f, j), количество измерений, попадающих в интервал от 16 до 30 см, превышает количество измерений, зарегистрированных для того же интервала, что и для длинной оси.Этот результат отражает общий сдвиг в размере в сторону меньших частот по сравнению с левым столбцом и подтверждает диагональную тенденцию в формах, проиллюстрированную диаграммами Снида-Фолка (рис. 4a – f). Асимметрия, отражающая включение очень крупных обломков, особенно очевидна на гистограммах на крайних концах палеобережья (рис. 4b, l). Самый крупный обломок базальта, выявленный во всем проекте, имел длинную ось 214 см, промежуточную ось 94 см и короткую ось 50 см (Таблица A6).

На пути к вакцине против малярии

Emerg Top Life Sci. 2017 Dec 22; 1 (6): 539–545.

Редактор мониторинга: Роберто Докампо

Франк Леннарц

1 Департамент биохимии, Оксфордский университет, Саут-Паркс-роуд, Оксфорд OX1 3QU, Великобритания

Томас Лавстсен

2 Центр медицинской паразитологии и микробиологии (ISIM), факультет здравоохранения и медицинских наук, Копенгагенский университет, Копенгаген, Дания

3 Отделение инфекционных заболеваний, Университетская больница Копенгагена (Rigshospitalet), Копенгаген, Дания

Matthew K.Хиггинс

1 Факультет биохимии Оксфордского университета, Саут-Паркс-Роуд, Оксфорд OX1 3QU, Великобритания

1 Факультет биохимии Оксфордского университета, Саут-Паркс-роуд, Оксфорд OX1 3QU, Великобритания

2 Центр медицинской паразитологии, Отделение иммунологии и микробиологии (ISIM), Факультет здравоохранения и медицинских наук, Копенгагенский университет, Копенгаген, Дания

3 Отделение инфекционных заболеваний, Больница Копенгагенского университета (Rigshospitalet), Копенгаген, Дания

Поступило 08.10.2017; Пересмотрено 1 ноября 2017 г .; Принята в печать 3 ноября 2017 г.

Abstract

Человеческие инфекционные паразиты, такие как вызывающие малярию, очень приспособлены к тому, чтобы уклоняться от очищения иммунной системой. В ситуациях, когда они должны поддерживать длительные взаимодействия с молекулами своего хозяина, они часто используют семейства поверхностных белков паразитов. Эти семейства очень разнообразны, чтобы предотвратить иммунное распознавание, и тем не менее, чтобы способствовать выживанию паразитов, их члены должны сохранять способность взаимодействовать со специфическими рецепторами человека. Одним из наиболее изученных семейств поверхностных белков паразитов являются белки PfEMP1 Plasmodium falciparum .Эти молекулы заставляют инфицированные эритроциты прикрепляться к человеческим рецепторам, находящимся на поверхности кровеносных сосудов и тканей. Это защищает находящегося внутри паразита от удаления селезенкой, а также вызывает симптомы тяжелой малярии. PfEMP1 подвергаются воздействию иммунной системы во время инфекции и поэтому являются отличными кандидатами в вакцины для использования в подходе для предотвращения тяжелых заболеваний. Ключевой вопрос, однако, заключается в том, мешает ли их обширное разнообразие формировать компоненты противомалярийных вакцин будущего?

Ключевые слова: малярия, поверхностный белок, вакцина

Будут ли иммуногены против болезней иметь место в будущих вакцинах против малярии?

Малярия — одна из самых древних болезней человечества, которая тысячелетиями передавалась вместе с млекопитающими.Он по-прежнему убивает около полумиллиона человек каждый год и вызывает сотни миллионов клинических случаев [1]. Поиски вакцины были долгими и сложными, и лучший на сегодняшний день пример — однокомпонентная вакцина RTS, S, показавшая свою эффективность лишь на 30% [2]. Таким образом, вакцины против малярии будущего, вероятно, станут более сложными и будут одновременно атаковать несколько стадий жизненного цикла паразитов [3,4]. Три главные цели, которые в настоящее время лидируют, — это молекулярные механизмы, используемые паразитом для вторжения в клетки печени человека, для вторжения в эритроциты или для слияния гамет в средней кишке комара.Эффективное предотвращение любого из этих важных шагов в жизненном цикле паразита заблокирует развитие паразита или остановит передачу другим человеческим хозяевам [5]. Одним из вариантов, который обеспечивает стерильную защиту иммунизированных добровольцев, но имеет проблемы, связанные с развертыванием в эндемичных по малярии регионах, являются вакцины на основе цельных паразитов, такие как аттенуированные спорозоиты [6]. Кроме того, для каждой стадии были определены многообещающие молекулярные мишени для вмешательства, включая компоненты циркумспорозоитного белка (CSP) для стадии печени (уже активный компонент вакцины RTS, S) [2], RH5 для стадии в крови [ 7,8] и HAP2, Pfs48 / 45 и Pfs230 для слияния гамет [9].Все они активно рассматриваются в качестве кандидатов на вакцины.

Другими возможными вариантами в списке целей являются белки, которые определяют, развиваются ли у малярийной инфекции тяжелые и опасные для жизни симптомы. Тяжелая форма малярии, которая может включать тяжелую анемию, респираторный дистресс или церебральные эффекты, встречается у людей, которые еще не подвергались повторным инфекциям Plasmodium falciparum и, следовательно, не выработали репертуар антител, способных управлять инфекцией [5].В эндемичных по малярии районах бремя тяжелой малярии больше всего ложится на детей в возрасте до 5 лет [10], тогда как по мере снижения передачи иммунитет приобретается в более позднем возрасте, а тяжелая форма малярии становится более распространенной среди детей старшего возраста [5,11].

Развитие тяжелых симптомов малярии происходит на стадии инфицирования крови и связано с экспрессией белков паразитов, обнаруживаемых на поверхности инфицированных эритроцитов, связывающих паразитов с эндотелием и тканями человека. Это предотвращает попадание инфицированных эритроцитов, которые были набухли из-за паразитов внутри, от фильтрации крови селезенкой человека.Это также приводит к воспалению, закупорке кровеносных сосудов и к симптомам тяжелой малярии, включая церебральную малярию и малярию, связанную с беременностью, которые характеризуются выраженной секвестрацией паразитов в головном мозге и плаценте [12]. Эндотелиальное связывание опосредуется мембранным белком 1 эритроцитов P. falciparum , PfEMP1, большим семейством белков с ~ 60 членами, кодируемыми в каждом геноме [13,14]. Каждый PfEMP1 формируется из множества копий двух типов доменов, специфичных для паразитов, доменов CIDR и DBL, которые чаще всего пространственно организованы в линейный массив () [15].Различные индивидуальные домены способны взаимодействовать со специфическими белками эндотелиальной поверхности человека, включая рецептор эндотелиального протеина C, EPCR [16], молекулу внутриклеточной адгезии 1, ICAM-1 [17] и кластер дифференцировки 36, CD36 [18].

Молекулярная основа связывания PfEMP1, связанного с тяжелым заболеванием, с рецепторами человека.

( A ) Архитектура эктодоменов PfEMP1, отображаемых на поверхности эритроцитов, инфицированных P. falciparum .Классические PfEMP1 имеют жесткую и удлиненную структуру [51], тогда как VAR2CSA — единственный известный PfEMP1, имеющий общую глобулярную структуру [52]. Указаны два типа доменов в PfEMP1, домены CIDR (желтый) и домены DBL (зеленый). ( B ) Кристаллическая структура домена CIDR (желтый), связанного с его человеческим рецептором, EPCR (синий). На вставке показаны остатки CIDR (красный), которые вступают в прямой контакт с EPCR и их сохранение в 737 EPCR-связывающих доменах CIDR, отображенных в виде логотипа последовательности [36].( C ) Кристаллическая структура домена DBL (зеленый), связанного с первыми двумя доменами его человеческого рецептора, ICAM-1 (синий). На вставке показаны остатки DBL (красный), которые непосредственно контактируют с ICAM-1, и логотип последовательности, показывающий их сохранение в 145 доменах DBL, связывающих ICAM-1 [38].

В некоторых отношениях PfEMP1 являются отличными кандидатами на вакцину. Они напрямую связаны с патогенезом малярии, постоянно подвергаются воздействию иммунной системы и являются мишенями для многих антител, вырабатываемых в ответ на инфекцию [19,20], что коррелирует с защитой от малярии [21].Таким образом, ожидается, что вакцина, которая вырабатывает антитела, которые нацелены на PfEMP1 и предотвращают адгезию эндотелия, значительно снизит частоту тяжелых симптомов и смертей от малярии.

Однако семейство PfEMP1 очень разнообразно. Как белки, которые постоянно подвергаются воздействию иммунной системы, давление отбора заставило их расшириться до большого и антигенно вариантного семейства белков, которое значительно различается между разными изолятами [13,14]. Популяция паразитов, высвобождаемых из печени, экспрессирует большинство PfEMP1, с сокращенным репертуаром, обнаруживаемым позже при инфекции [22,23].Это максимизирует вероятность установления инфекции независимо от иммунного статуса или доступности рецепторов хозяина. Затем переключение генов, экспрессирующих PfEMP1, позволяет паразиту адаптироваться к иммунному заражению, увеличивая вероятность выживания и перехода к новому вектору, что, возможно, наиболее существенно в течение длительных периодов низкой передачи.

Итак, в какой степени семейство PfEMP1 слишком сложное и слишком разнообразное для терапевтического воздействия? Будет ли когда-нибудь возможно генерировать иммуногены вакцины, которые индуцируют широко ингибирующий ответ против такого семейства белков? Чтобы ответить на эти вопросы, нам нужно понять, на какие PfEMP1 следует воздействовать из-за их специфической связи с тяжелыми формами малярии.Нам также необходимо понять их структуру и определить, сохраняют ли они способность связываться со специфическими эндотелиальными рецепторами через консервативные сайты связывания, и могут ли эти сайты имитироваться иммуногенами вакцины. Если экспрессия специфических PfEMP1 приводит к развитию тяжелой малярии, и если эти PfEMP1 используют консервативные поверхности для связывания лиганда, тогда можно будет включить их производные в будущие вакцины в качестве компонентов, предназначенных для снижения случаев смерти и тяжелых заболеваний.

Какие белки PfEMP1 связаны с фенотипами конкретных заболеваний?

Только у части случаев малярии развиваются тяжелые симптомы. При наличии множества различных PfEMP1 в геноме главный вопрос, следовательно, заключается в том, связаны ли специфические PfEMP1 со специфическими рецептор-связывающими фенотипами с конкретными синдромами тяжелого заболевания. Действительно, предполагается, что домены PfEMP1 взаимодействуют с широким спектром различных белковых и углеводных лигандов человека [24,25]. Это вызывает несколько вопросов.Какие реальные, физиологически релевантные взаимодействия и какие связывающие фенотипы связаны с конкретными тяжелыми фенотипами малярии? Если такие связи можно будет продемонстрировать, то список компонентов вакцины на основе PfEMP1 уменьшится.

Первый лиганд-связывающий фенотип PfEMP1, связанный с синдромом конкретного заболевания, был обнаружен для связанной с беременностью малярии. Здесь единственный PfEMP1 в геноме каждого паразита, известный как VAR2CSA, специфически экспрессировался у паразитов, выделенных от беременных женщин, страдающих от малярии [26,27].VAR2CSA опосредует секвестрацию инфицированных эритроцитов, связываясь с хондроитинсульфатами, которые заполняют пространства плаценты при контакте с материнской кровью [26,28]. Поскольку с этой формой заболевания связан только один PfEMP1, а иммунитет к связанной с беременностью малярии у многоплодных женщин связан с антителами, связывающими VAR2CSA [29], это многообещающая вакцина-кандидат, которая проходит клинические испытания [30]. .

Связь конкретных PfEMP1 с тяжелой малярией и идентификация их партнеров по связыванию оказались более сложной задачей.Сужение поиска потребовало обширного анализа последовательностей и классификации доменов PfEMP1 [14]. Во-первых, PfEMP1 были организованы в группы A, B и C, в зависимости от их хромосомного положения и типов кодируемых доменов [31]. Экспрессия подмножества PfEMP1s, которые содержат специфический набор доменов, известных как домены CIDRα1, была связана с тяжелой малярией или связыванием эндотелиальных клеток мозга [32–35]. Позже было обнаружено, что домены CIDRα1 связываются с человеческим EPCR [16], тем самым предотвращая взаимодействие EPCR с его естественным лигандом, активированным протеином C [16,36] ().Предполагается, что блокировка EPCR-опосредованной передачи сигналов через связывание PfEMP1 приводит к локализованному воспалению и симптомам тяжелого заболевания [12,16,36,37].

Хотя экспрессия EPCR-связывающих PfEMP1s была связана со всеми формами тяжелой малярии [16,38–41], вероятно, из-за широкого тканевого тропизма, эффективной секвестрации и предполагаемых патогенных последствий связывания рецепторов, она не связана специально с развитие церебральной болезни. Особая связь с церебральными симптомами была обнаружена у паразитов, экспрессирующих PfEMP1, которые объединяют как EPCR-связывающий домен CIDRα1, так и домен DBLβ, который может связываться с ICAM-1, что позволяет одновременно связывать инфицированные эритроциты с обоими лигандами [38,42,43] ( ).

Связь между этими типами PfEMP1 и тяжелой или церебральной малярией не абсолютна [16,38,44]. Тем не менее, экспрессия этих PfEMP1 является значительным фактором риска развития тяжелых симптомов малярии, а ингибирующие антитела, нацеленные на их соответствующие рецептор-связывающие домены, обнаруживаются у выживших пациентов [36,38]. Хотя еще многое предстоит узнать о PfEMP1, эти группы доменов являются очень многообещающими кандидатами для нацеливания в попытках уменьшить разрушительные симптомы тяжелой малярии.

Идентификация консервативных рецептор-связывающих поверхностей на PfEMP1s

Идентификация групп PfEMP1s [45], ассоциированных со специфическими синдромами заболевания, является значительным шагом вперед. Но подходят ли эти молекулы для включения в вакцину? Лучшим примером прогресса в создании эффективной вакцины на основе PfEMP1 является VAR2CSA. Здесь иммуноген был сужен до фрагмента ~ 60 кДа, который имеет такое же сродство и специфичность к хондроитинсульфатам, что и полный белок. Антитела, полученные против этого фрагмента, распознают инфицированные эритроциты и блокируют связывание с хондроитинсульфатом [46].VAR2CSA проходит клинические испытания на людях в качестве вакцины-кандидата [30].

Однако VAR2CSA не является классическим PfEMP1, поскольку он лежит вне нормальной организации семейства белков и кодируется одним относительно консервативным геном в геноме каждого паразита [26,27,45]. А как насчет более классических членов семейства PfEMP1? Обладают ли ICAM-1 или EPCR-связывающие PfEMP1, ассоциированные с тяжелым заболеванием, свойствами вакцинных иммуногенов? Сочетание структурных исследований и обширного геномного анализа выявило степень, в которой эти PfEMP1 остаются консервативными, чтобы позволить связывание рецептора, и дополнительно идентифицировали области лиганд-связывающих доменов, которые могут быть имитированы в иммуногенах [36,38,47] ().Остатки, важные для связывания ICAM-1 в доменах DBLβ, связанных с церебральной малярией, в высшей степени консервативны [38]. Напротив, EPCR-связывающие домены CIDRα1 более сложные, с небольшой консервативностью прямой последовательности [36]. Однако, несмотря на такое разнообразие последовательностей, EPCR-связывающая поверхность преимущественно образована из изогнутой спирали, которая является консервативной по форме и химическому составу, что указывает на возможность создания иммуногена, который имитирует эти особенности и может индуцировать перекрестно-реактивные антитела.Также ожидается, что эти особенности останутся консервативными, чтобы позволить доменам CIDRα1 продолжать связываться с EPCR, ограничивая ускользание от иммунной системы.

От структурной консервации к иммуногену вакцины?

Несмотря на то, что еще многое предстоит узнать о семействе PfEMP1, недавние исследования позволили преодолеть часть их сложности, выявив фенотипы связывания, связанные с синдромами тяжелых заболеваний, и охарактеризовав консервативные структурные особенности, которые опосредуют связывание рецепторов. Это выявило важные принципы, которые могут быть общими для других PfEMP1 или других семейств поверхностных белков паразитов, таких как RIFIN, которые менее изучены, но предположительно вносят вклад в патогенез малярии [48].Например, подлинные фенотипы связывания могут быть обнаружены у многих членов семейства и могут быть предсказаны на основе последовательности, если ее понять на молекулярном уровне. Кроме того, сохранение формы и структуры, вероятно, позволит поддерживать связывание с инвариантными рецепторами человека, несмотря на большое разнообразие последовательностей.

Остается вопрос, можно ли использовать эти идеи для разработки улучшенных иммуногенов вакцины. Позволит ли знание химически консервативных поверхностей, которые обеспечивают связывание рецепторов, создавать молекулы, имитирующие эти области? Будут ли эти молекулы вырабатывать антитела, которые специфически нацелены на консервативную химию сайтов связывания рецепторов, и будут ли эти антитела иметь нейтрализующий потенциал в широком смысле?

Недавние достижения в разработке вакцины на основе структуры вселяют надежду на то, что ключевые рецептор-связывающие сайты доменов PfEMP1 могут быть имитированы в разработанных иммуногенах.Этого можно достичь путем трансплантации критических эпитопов из доменов PfEMP1 на гораздо меньшие, слабоиммуногенные каркасы, метод, который успешно использовался при разработке вирусных вакцин [49,50]. В случае респираторно-синцитиального вируса создание таких иммуногенов, которые специфически представляют эпитопы для защитных ингибирующих антител, привело к их повторной активации [50]. Есть надежда, что использование аналогичных инструментов проектирования для разнообразного семейства белков, таких как PfEMP1, будет генерировать антитела, которые специфически нацелены на функционально важные и структурно консервативные поверхности, блокируя процессы, важные для патогенеза, и уменьшая заболеваемость.

Многие считают, что семейства поверхностных белков, такие как PfEMP1, слишком сложно нацелить вакцины, поскольку их разнообразие настолько велико, что ни один иммуноген не сможет вырабатывать антитела, которые нейтрализуют функцию всей семьи. В самом деле, нет сомнений в том, что будет легче генерировать широко нейтрализующие антитела, которые нацелены на более консервативные белки, такие как антиген малярии на стадии крови RH5 или антиген на стадии печени CSP. Однако для конкретных PfEMP1, связанных с определенными фенотипами связывания, есть надежда.Чтобы сохранить способность связываться со своими консервативными человеческими лигандами, эти PfEMP1 должны сохранять форму и химические свойства своих рецептор-связывающих поверхностей. Таким образом, идентификация взаимодействий, связанных с тяжелым заболеванием, и характеристика критически важных консервативных признаков обеспечивает основу, необходимую для этих исследований дизайна иммуногена. Будет интересно увидеть, в какой степени новейшие инструменты в дизайне белков теперь позволяют производить такие иммуногены, и в какой степени они вызывают широко реактивные иммунные ответы.В случае успеха такие иммуногены могут составить ценную часть многоэтапных противомалярийных вакцин будущего.

Резюме

  • Малярийные вакцины будущего, вероятно, будут многокомпонентными.

  • Разработка компонента для предотвращения тяжелого заболевания включает нацеливание на семейства поверхностных белков паразитов, такие как PfEMP1.

  • Они разнообразны и сложны. Однако недавние исследования идентифицировали PfEMP1, ассоциированный с тяжелым заболеванием, и идентифицировали консервативные лиганд-связывающие поверхности.

Сокращения

рецептор Даффи- E- рецептор Даффи-9028
CIDR Междоменная область, богатая цистеином
CSP Цикмспорозоитный белок
DBL ICAM-1 молекула внутриклеточной адгезии 1
PfEMP1 P. falciparum мембранный белок эритроцитов 1.

Конкурирующие интересы

Авторы заявляют об отсутствии конкурирующих интересов, связанных с рукописью.

Список литературы

1. Всемирная организация здравоохранения Мировой доклад о малярии, 2015 г.

2. RTS, S Clinical Trials Partnership (2015) Эффективность и безопасность вакцины против малярии RTS, S / AS01 с бустерной дозой или без нее у младенцев и детей в Африке: окончательные результаты фазы 3, индивидуально рандомизированные, контролируемое испытание. Ланцет 386, 31–45 10.1016 / S0140-6736 (15) 60721-8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 3. Дрейпер С.Дж., Ангов Э., Хорий Т., Миллер Л.Х., Сринивасан П., Тайзен М. и др. (2015) Последние достижения в области рекомбинантных белковых вакцин против малярии. Вакцина 33, 7433–7443 10.1016 / j.vaccine.2015.09.093 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Хоффман С.Л., Векеманс Дж., Ричи Т.Л. и Даффи П. (2015) Марш к вакцинам против малярии. Являюсь. J. Prev. Med. 49 (6 доп. 4), S319 – S333 10.1016 / j.amepre.2015.09.011 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 5. Ковман А.Ф., Целитель Дж., Марапана Д. и Марш К. (2016) Малярия: биология и болезни. Клетка 167, 610–624 10.1016 / j.cell.2016.07.055 [PubMed] [CrossRef] [Google Scholar] 6. Мордмюллер Б., Сурат Г., Лаглер Х., Чакраварти С., Ишизука А.С., Лалремруата А. и др. (2017) Стерильная защита от малярии человека с помощью хемоаттенуированной вакцины PfSPZ. Природа 542, 445–449 10.1038 / nature21060 [PubMed] [CrossRef] [Google Scholar] 7. Дуглас А.Д., Бальдевиано Г.К., Лукас К.М., Луго-Роман Л.А., Кроснье К., Бартольдсон С.Дж. и другие. (2015) Вакцина на основе PfRH5 эффективна против инфекции гетерологичного штамма Plasmodium falciparum у обезьян aotus. Клеточный микроб-хозяин 17, 130–139 10.1016 / j.chom.2014.11.017 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 8. Райт К.Э., Хьеррилд К.А., Бартлетт Дж., Дуглас А.Д., Джин Дж., Браун Р.Э. и другие. (2014) Структура белка инвазии малярии RH5 с базигином эритроцитов и блокирующими антителами.Природа 515, 427–430 10.1038 / nature13715 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Капулу М.С., Да Д.Ф., Миура К., Ли Ю., Благборо А.М., Черчер Т.С. и другие. (2015) Сравнительная оценка вакцин-кандидатов, блокирующих передачу, против Plasmodium falciparum . Sci. Rep. 5, 11193 10.1038 / srep11193 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 10. Лангхорн Дж., Ндунгу Ф.М., Спонаас А.-М. и Марш К. (2008) Иммунитет к малярии: больше вопросов, чем ответов.Nat. Иммунол. 9, 725–732 10.1038 / ni.f.205 [PubMed] [CrossRef] [Google Scholar] 11. Сноу Р.В., Омумбо Дж.А., Лоу Б., Молинье К.С., Обьеро Ж.-О., Палмер А. и др. (1997) Связь между тяжелой заболеваемостью малярией у детей и уровнем передачи Plasmodium falciparum в Африке. Ланцет 349, 1650–1654 10.1016 / S0140-6736 (97) 02038-2 [PubMed] [CrossRef] [Google Scholar] 12. Смит Дж. Д., Роу Дж. А., Хиггинс М. К. и Lavstsen T. (2013) Смертельная хватка малярии: цитоадгезия эритроцитов, инфицированных Plasmodium falciparum .Cell Microbiol. 15, 1976–1983 гг. 10.1111 / cmi.12183 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 13. Гарднер М.Дж., Холл Н., Фунг Э., Уайт О., Берриман М., Хайман Р.В. и др. (2002) Последовательность генома малярийного паразита человека Plasmodium falciparum . Природа 419, 498–511 10.1038 / nature01097 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Раск Т.С., Хансен Д.А., Теандер Т.Г., Педерсен А.Г. и Лавстсен Т. (2010) Plasmodium falciparum Разнообразие мембранного белка 1 эритроцитов в семи геномах — разделяй и властвуй.PLoS Comput. Биол. 6, e1000933 10.1371 / journal.pcbi.1000933 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Хиггинс М.К. и Carrington M. (2014) Вариация последовательностей и структурная консервация позволяют развивать новую функцию и уклонение от иммунитета в семействах поверхностных белков паразитов. Protein Sci. 23, 354–365 10.1002 / pro.2428 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16. Turner L., Lavstsen T., Berger S.S., Wang C.W., Petersen J.E.V., Avril M. et al. (2013) Тяжелая форма малярии связана со связыванием паразитов с рецептором эндотелиального протеина С.Природа 498, 502–505 10.1038 / nature12216 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 17. Берендт А.Р., Симмонс Д.Л., Танси Дж., Ньюболд К.И. и Марш К. (1989). Молекула-1 межклеточной адгезии является рецептором адгезии эндотелиальных клеток для Plasmodium falciparum . Природа 341, 57–59 10.1038 / 341057a0 [PubMed] [CrossRef] [Google Scholar] 18. Окенхаус К.Ф., Тандон Н.Н., Магован К., Джеймисон Г.А. и Chulay J.D. (1989) Идентификация гликопротеина тромбоцитарной мембраны как рецептора секвестрации малярии falciparum.Наука 243, 1469–1471 10.1126 / science.2467377 [PubMed] [CrossRef] [Google Scholar] 19. Булл П.С., Лоу Б.С., Корток М., Молинье К.С., Ньюболд К.И. и Марш К. (1998) Антигены паразитов на инфицированной поверхности эритроцитов являются мишенями для естественного иммунитета к малярии. Nat. Med. 4, 358–360 10.1038 / nm0398-358 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Чан Дж.-А., Хауэлл К.Б., Рейлинг Л., Атаиде Р., Макинтош К.Л., Фаукс Ф.Дж.И. и другие. (2012) Мишени антител против эритроцитов, инфицированных Plasmodium falciparum , при иммунитете к малярии.J. Clin. Вкладывать деньги. 122, 3227–3238 10.1172 / JCI62182 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 21. Bull P.C. и Абди А. (2016) Роль PfEMP1 как мишени естественного иммунитета к детской малярии: перспективы вакцины. Паразитология 143, 171–186 10.1017 / S0031182015001274 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 22. Lavstsen T., Magistrado P., Hermsen C.C., Salanti A., Jensen A.T.R., Sauerwein R. et al. (2005) Экспрессия Plasmodium falciparum мембранного белка 1 эритроцитов у экспериментально инфицированных людей.Малар. Дж. 4, 21 10.1186 / 1475-2875-4-21 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23. Ван К.В., Магистрадо П.А., Нильсен М.А., Теандр Т.Г. и Lavstsen T. (2009). Предпочтительная транскрипция консервативных генов rif в двух фенотипически различных линиях паразитов Plasmodium falciparum . Int. J. Parasitol. 39, 655–664 10.1016 / j.ijpara.2008.11.014 [PubMed] [CrossRef] [Google Scholar] 24. Роу Дж. А., Классенс А., Корриган Р. А. и Арман М. (2009) Адгезия эритроцитов, инфицированных Plasmodium falciparum , к клеткам человека: молекулярные механизмы и терапевтическое значение.Эксперт Преподобный Мол. Med. 11, е16 10.1017 / S146239940

82 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25. Эссер К., Бахманн А., Кун Д., Шульдт К., Фёрстер Б., Тиль М. и др. (2014) Доказательства беспорядочного связывания эндотелия эритроцитами, инфицированными Plasmodium falciparum . Клетка. Microbiol. 16, 701–708 10.1111 / cmi.12270 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 26. Саланти А., Дальбек М., Тернер Л., Нильсен М.А., Барфод Л., Магистрадо П. и др. (2004) Доказательства участия VAR2CSA в связанной с беременностью малярии.J. Exp. Med. 200, 1197–1203 10.1084 / jem.20041579 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 27. Salanti A., Staalsoe T., Lavstsen T., Jensen A.T.R., Sowa M.P.K., Arnot D.E. и другие. (2003) Селективная активация одного четко структурированного гена var в хондроитинсульфате A-прилипшем к Plasmodium falciparum , вовлеченном в ассоциированную с беременностью малярию. Мол. Microbiol. 49, 179–191 10.1046 / j.1365-2958.2003.03570.x [PubMed] [CrossRef] [Google Scholar] 28. Фрид М.и Даффи П. (1996) Присоединение Plasmodium falciparum к хондроитинсульфату А в плаценте человека. Наука 272, 1502–1504 10.1126 / science.272.5267.1502 [PubMed] [CrossRef] [Google Scholar] 29. Фрид М., Ностен Ф., Брокман А., Брабин Б.Дж. и Даффи П.Е. (1998) Материнские антитела блокируют малярию. Природа 395, 851–852 10.1038 / 27570 [PubMed] [CrossRef] [Google Scholar] 30. Pehrson C., Salanti A., Theander T.G. и Nielsen M.A. (2017) Доклиническая и клиническая разработка первой плацентарной вакцины против малярии.Эксперт Преп. Вакцины 16, 613–624 10.1080 / 14760584.2017.1322512 [PubMed] [CrossRef] [Google Scholar] 31. Лавсцен Т., Саланти А., Йенсен А.Т., Арнот Д.Е. и Теандр Т. (2003) Подгруппа генов Plasmodium falciparum 3D7 var на основе анализа последовательностей кодирующих и некодирующих областей. Малар. Дж. 2, 27 10.1186 / 1475-2875-2-27 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32. Lavstsen T., Turner L., Saguti F., Magistrado P., Rask T..S., Jespersen J.S. и другие. (2012) Plasmodium falciparum Кассеты 8 и 13 домена мембранного белка 1 эритроцитов связаны с тяжелой формой малярии у детей.Proc. Natl Acad. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 109, E1791 – E1800 10.1073 / pnas.1120455109 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Jensen A.T.R., Magistrado P., Sharp S., Joergensen L., Lavstsen T., Chiucchiuini A. et al. (2004) Plasmodium falciparum , ассоциированный с тяжелой детской малярией, предпочтительно экспрессирует PfEMP1, кодируемый генами группы A var . J. Exp. Med. 199, 1179–1190 10.1084 / jem.20040274 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Классенс А., Адамс Ю., Гумра А., Линдергард Г., Бьюкен К.С., Андиси С. и др. (2012) Подмножество групп A-подобных генов var кодирует лиганды малярийного паразита для связывания с эндотелиальными клетками мозга человека. Proc. Natl Acad. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 109, E1772 – E1781 10.1073 / pnas.1120461109 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 35. Аврил М., Трипати А.К., Брейзер А.Дж., Андиси К., Джейнс Дж.Х., Сома В.Л. и другие. (2012) Ограниченный набор генов var опосредует прикрепление эритроцитов, инфицированных Plasmodium falciparum , к эндотелиальным клеткам головного мозга.Proc. Natl Acad. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 109, E1782 – E1790 10.1073 / pnas.1120534109 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 36. Лау К.К.Й., Тернер Л., Джесперсен Дж. С., Лоу Е. Д., Петерсен Б., Ван С. В. и др. (2015) Структурная консервация, несмотря на огромное разнообразие последовательностей, позволяет связывать EPCR семейством PfEMP1, участвующим в тяжелой детской малярии. Клеточный микроб-хозяин 17, 118–129 10.1016 / j.chom.2014.11.007 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 37. Петерсен J.E.V., Bouwens E.A.M., Тамайо И., Тернер Л., Ван С.В., Стинс М. и др. (2015) Дефекты системы протеина C, вызванные белком малярийного паразита PfEMP1, можно преодолеть с помощью растворимого варианта EPCR. Тромб. Гемост. 114, 1038–1048 10.1160 / Th25-01-0018 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 38. Леннарц Ф., Адамс Ю., Бенгтссон А., Олсен Р.В., Тернер Л., Ндам Н.Т. и другие. (2017) Идентификация на основе структуры семейства PfEMP1, связывающегося с двойным рецептором, которое связано с церебральной малярией. Клеточный микроб-хозяин 21, 403–414 10.1016 / j.chom.2017.02.009 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 39. Jespersen J.S., Wang C.W., Mkumbaye S.I., Minja D.T.R., Petersen B., Turner L. et al. (2016) Гены Plasmodium falciparum var , экспрессируемые у детей с тяжелой формой малярии, кодируют домены CIDRα1. EMBO Mol. Med. 8, 839–850 10.15252 / emmm.201606188 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. Бернабеу М., Данцигер С.А., Аврил М., Ваз М., Бабар П.Х., Брейзер А.Дж. и другие. (2016) Тяжелая форма малярии у взрослых связана со специфическими типами адгезии PfEMP1 и высокой биомассой паразитов.Proc. Natl Acad. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 113, E3270 – E3279 10.1073 / pnas.1524294113 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Аврил М., Бернабеу М., Бенджамин М., Брейзер А.Дж. и Smith J.D. (2016) Взаимодействие между рецептором эндотелиального протеина C и молекулой межклеточной адгезии 1 для опосредования связывания эритроцитов, инфицированных Plasmodium falciparum , с эндотелиальными клетками. мБио 7, e00615-16 10.1128 / mBio.00615-16 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 43. Туйкуэ Ндам Н., Moussiliou A., Lavstsen T., Kamaliddin C., Jensen A.T.R., Mama A. et al. (2017) Паразиты, вызывающие церебральную малярию falciparum, связывают несколько эндотелиальных рецепторов и экспрессируют EPCR и ICAM-1-связывающий PfEMP1. J. Infect. Дис. 215, 1918–1925 гг. 10.1093 / infdis / jix230 [PubMed] [CrossRef] [Google Scholar] 44. Нунес-Сильва С., Дечаванн С., Муссилиу А., Пстраг Н., Семблат Ж.-П., Гангнард С. и др. (2015) Бенинские дети с церебральной малярией не развивают гуморальный иммунитет против варианта IT4-VAR19-DC8 PfEMP1, связанного с EPCR и связыванием эндотелия мозга.Малар. Дж. 14, 493 10.1186 / s12936-015-1008-5 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 45. Bockhorst J., Lu F., Janes J.H., Keebler J., Gamain B., Awadalla P. et al. (2007) Структурный полиморфизм и диверсифицирующий отбор кандидата на вакцину против малярии для беременных VAR2CSA. Мол. Biochem. Паразитол. 155, 103–112 10.1016 / j.molbiopara.2007.06.007 [PubMed] [CrossRef] [Google Scholar] 46. Clausen T.M., Christoffersen S., Dahlback M., Langkilde A.E., Jensen K.E., Resende M. et al. (2012) Структурное и функциональное понимание того, как белок Plasmodium falciparum VAR2CSA опосредует связывание с хондроитинсульфатом А при плацентарной малярии.J. Biol. Chem. 287, 23332–23345 10.1074 / jbc.M112.348839 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Hsieh F.-L., Turner L., Bolla J.R., Robinson C.V., Lavstsen T. и Higgins M.K. (2016) Структурная основа связывания CD36 малярийным паразитом. Nat. Commun. 7, 12837 10.1038 / ncomms12837 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 48. Wahlgren M., Goel S. и Akhouri R.R. (2017) Варианты поверхностных антигенов Plasmodium falciparum и их роль в тяжелой форме малярии.Nat. Rev. Microbiol. 15, 479–491 10.1038 / nrmicro.2017.47 [PubMed] [CrossRef] [Google Scholar] 49. Азоитей М.Л., Коррейя Б.Е., Бан Я.-Э.А., Каррико К., Калюжный О., Чен Л. и др. (2011) Трансплантация прерывистого мотива на белковый каркас под управлением вычислений. Наука 334, 373–376 10.1126 / science.1209368 [PubMed] [CrossRef] [Google Scholar] 50. Коррейя Б.Э., Бейтс Дж. Т., Лумис Р. Дж., Бэйникс Г., Каррико К., Джардин Дж. Г. и другие. (2014) Доказательство принципа разработки вакцины, ориентированной на эпитопы.Природа 507, 201–206 10.1038 / nature12966 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 51. Браун А., Тернер Л., Кристофферсен С., Эндрюс К.А., Шестак Т., Чжао Ю. и др. (2013) Молекулярная архитектура комплекса между адгезионным белком малярийного паразита и молекулой внутриклеточной адгезии 1. J. Biol. Chem. 288, 5992–6003 10.1074 / jbc.M112.416347 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 52. Шривастава А., Гангнард С., Раунд А., Дечаванн С., Жюльерат А., Райналь Б.и другие. (2010) Полноразмерная внеклеточная область var2CSA варианта PfEMP1 необходима для специфического высокоаффинного связывания с CSA. Proc. Natl Acad. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 107, 4884–4889 10.1073 / pnas.1000951107 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Двигатель ВАЗ-21126. Характеристики

Двигатель ВАЗ-21126 рядный, инжекторный, четырехтактный, распредвалы расположены вверху. Как и в большинстве современных двигателей, охлаждающая жидкость замкнута, имеет принудительную циркуляцию. Смазка узлов двигателя производится распылением под давлением.Двигатели используются в современных моделях ВАЗ — «Приора» и далее.

Отличительные особенности двигателя

Установка двигателя ВАЗ-21126 на всю серию Лада Приора, а также на его модификацию. Некоторые автолюбители без особых переделок ставят такие моторы на «десятку» и двенадцатую. Своеобразный тюнинг, позволяющий использовать больше опций — возможна установка кондиционера Гур без доработки. В то же время двигатель серии разработки 11194, следовательно, большинство компонентов одинаковы, независимо от того, какой объем двигателя является значительным.В задачу разработчиков в конструкцию входило значительно увеличить ресурс двигателя. И достичь цели, если увеличить время жизни всех отдельных узлов.

Автомобиль «Приор» с двигателем 21126 разработан на базе одноименного агрегата модели ВАЗ-21124. Но у них много отличий: уменьшенный вес и размеры всех элементов. Например, поршни в том же пространстве имеют на модели 21126 массу на сто грамм меньше. Высота ледяной глыбы 197,1 мм — это расстояние от оси вращения коленчатого вала двигателя до верхней поверхности.Конструктивных отличий от используемого в двигателе 21124 блока 11193-1002011 нет. Основные характеристики — это исключительно высокое качество обработки цилиндров и измененная в разы высота.

Рекомендуем

Как работает сайлентблок задний переднего рычага и сколько он служит?

Сайлентблок задний переднего рычага — один из составных элементов ходовой части автомобиля. Он относится к направляющим элементам подвески вместе с рычагами, выдерживающим колоссальные нагрузки колесами.Однако с этим товаром их много …

Расход масла в двигателе. Шесть причин

Вряд ли можно найти автомобилиста, которого бы не волновал повышенный расход масла. Особенно раздражает, когда это происходит с другим новым мотором. Вот наиболее частые причины, которые приводят к расходу масла в двигателе …

Как работает выхлопная система?

Выхлопная система предназначена для удаления продуктов сгорания из двигателя и вывода их в окружающую среду.Также должно быть обеспечено снижение шумового загрязнения до приемлемых пределов. Как и любые другие сложные устройства, эта система состоит из нескольких …

Основные характеристики двигателя

Двигатель ВАЗ-21126 имеет рабочий объем 1,6 литра (фактически 1597). Степень сжатия у мотора нормальная 11, всего 4 цилиндра. Суммарная мощность при 5600 оборотах в минуту — 98 л.с. или 72 кВт. Коленчатый вал на холостом ходу вращается с частотой 800-850 об / мин. При частоте вращения коленчатого вала 4000 об / мин двигатель развивает максимальный крутящий момент 145 Н * м.Такими данными обладает двигатель 21126. Цена бывшего в употреблении механизма от 25000 руб. Новые стоят намного дороже.

Характеристики поршня:

  1. Ход поршня 75,6 мм.
  2. Диаметр моторного цилиндра 82 мм.
  3. Количество клапанов -16.
  4. Рабочие цилиндры по схеме 1-3-4-2.

Распределенное управление впрыском через цифровой блок. При работе двигателя на неэтилированном бензине И-95 воспламенение смеси происходит от искрового зажигания типа АУ17ДВРМ или БЦПР6ЭС (НГК).Вес двигателя в сборе — около 115 кг.

Двигатель поршневой

Развитие поршневой группы — это заслуга компании Federal Mogul. Специалисты изготовили элементы мотора, масса которых значительно ниже, чем у двигателей ВАЗ-21124 — предшественников. Но если сравнить с ВАЗ-2110, то будет видно, что масса поршневой группы упала примерно на треть. Диаметр поршня не изменился, но значительно уменьшилась высота. Также использовали более тонкое поршневое кольцо и меньшие пальцы.Это напрямую влияет на скоростные и мощностные характеристики двигателя. Чем проще будет продвигать себя, тем больше власти он получит.

Внизу поршней имеется отверстие небольшой глубины. Отверстие для крепления шатуна пальца смещено от оси на полмиллиметра. Диаметр отверстия для установки поршневого пальца — 18 мм. Крепление производится с помощью плоскогубцев для стопорных колец, шатун устанавливается в поршень с минимальным зазором. Это обеспечивает наименьшее смещение оси шатуна по шейке коленчатого вала.

Кривошипно-шатунный механизм

Обязательно хонингование — нанесение небольшого рисунка в виде сетки на внутреннюю поверхность расточки цилиндра. Качество рабочей поверхности высокое, так как технология обработки Federal Mogul. Маркировка блока двигателя ВАЗ-21126 16 клапанов индексом 1002011, он нанесен на металлическую поверхность. Цвет агрегата данной модели — серый.

Цилиндры 21126 имеют три размера класса, различающиеся на 0,01 мм (обозначены буквенными индексами A, b и C).Коленчатый вал, используемый в двигателе, имеет индекс 11183-1005016. Размеры сиденья должны были точно соответствовать коленвалу ВАЗ-2112. Но с небольшими отличиями: на модификации 11183 увеличен радиус кривошипно-шатунного механизма (37,8 мм), полный ход поршней составляет 75,6 мм. Чтобы отличать кривошип от других моделей, противовес имеет соответствующее обозначение.

Приводы двигателя

Шкив коленчатого вала включает шестерню, тип которой обозначен индексом 21126. Зубья шкива предназначены для работы с ремнем ГРМ, имеющим полукруглый зуб.Чтобы ремень не проскальзывал при работе, с одной стороны есть небольшая металлическая полоса (фланец). С обратной стороны установлена ​​шайба. К коленчатому валу крепится демпфер-демпфер модели 2112. Он необходим для привода навесного оборудования и генератора.

На шкиве еще установлена ​​зубчатая шайба, которая необходима для работы датчика положения коленчатого вала. Для приведения в движение дополнительного оборудования — генератора, насоса гидроусилителя руля использован ремень поликлинового типа длиной 1115 мм, он имеет обозначение 2110-1041020.Если нет мощности, то использовали поликлиновой ремень типа 2110-3701720, длина которого составляет 742 мм. при наличии автомобильного кондиционера обеспечивает движение всего оборудования ремнем типа 2110-8114096, длина которого — 1125 мм.

Поршневые кольца и пальцы

Диаметр колец 82 мм, они тонкие, в отличие от традиционных ваз. Высота:

  1. Компрессия — 1,2 мм (вверху), 1,5 мм (внизу).
  2. Масло & ndash; 2 мм.

Наружный диаметр пальцев 18 мм при длине 53 мм.Отличие от предшественников существенное. За счет использования легких элементов получается увеличение мощности, КПД, крутящего момента.

Установить скорость автомобиля быстрее. Но это отражается на всех остальных агрегатах автомобиля — необходимо использовать более эффективную тормозную систему, установить качественные вентилируемые диски, тормозные колодки. Поэтому при самостоятельной настройке обращайте внимание на все детали.

Шатун двигателя 21126

Эта технология используется в более тонком контакте с коленчатым валом у шатуна, что значительно улучшает характеристики двигателя.Благодаря использованию такой конструкции удалось снизить трение в узлах, что значительно повысило грузоподъемность и эффективность. Класс точности поршня должен соответствовать показателям блока цилиндров ДВС. Маркировка поршней находится на поверхности днища.

Двигатель ВАЗ-21126 имеет тягу более легкую, чем у модели 21124. При изготовлении по последнему слову техники. Длина — 133,32 мм. часть стержня преформы исламипедия — получается крышка.Благодаря этому способу не удается точно совместить поверхности изделий. Крепление крышки осуществляется саморезами, повторное использование которых недопустимо. Ушки для шатунов имеют ширину 17,2 мм.

Головка блока цилиндров двигателя ВАЗ-21126

Головка блока двух распредвалов и 16 клапанов, модель 2112 отличается тем, что площади для установки автоматического натяжителя ремня немного больше. Также с размахом изменился размер площадки под фланцы выхлопной трубы. Клапаны, пружины для них, гидроподъемники и распредвалы — все как на модели 2112, никакой разницы нет.Обозначим шкивы распределительного вала:

  1. Два кружка, расположенные возле зубьев, по обе стороны от отметки — конечные.
  2. Один патрон с левой стороны этикетки — входной.

С помощью гидравлических толкателей получается автоматическая компенсация зазоров в приводах клапанов. Поэтому при эксплуатации автомобиля с этим мотором отпадает необходимость регулировки зазоров клапанов. Оригинальная конструкция системы автоматического натяжения ремня ГРМ нового типа, ранее не применялись применяемые типы роликов.Ремень 137 зубьев с другим типом профиля. Это повлекло за собой установку насоса новой конструкции, более эффективного, чем использовавшийся ранее.

Топливно-выхлопная система

Каталитический нейтрализатор, используемый в двигателе 21126, характеристики которого сильно зависят от выхлопной системы, более чем идеален. Его диаметр больше, чем у модели 21124.

Различные типы коллекторов, обеспечивающих соответствие нормам токсичности Евро-3 и Евро-4.В двигателе установлено 4 катушки зажигания — по одной на каждую свечу. Это исключает использование высоковольтных проводов.

Топливная система немного отличается от той, которая использовалась на ранних моделях. Рампа из нержавеющей стали, инжектор — Bosch, Siemens, Mercedes. Впрыск фазированный, управляемый датчиками, исполнительными механизмами, подключенными к микроконтроллерной системе управления «Январь-7.2» или М-7.9.7.

Электронные журналы Thieme — Synlett / Abstract

Synlett 2020; 31 (05): 455-458
DOI: 10.1055 / s-0039-16

© Георг Тим Верлаг Штутгарт · Нью-Йорк

Тамал Рой

,

Выражаем признательность за щедрую поддержку со стороны химического факультета Копенгагенского университета и фонда Novo Nordisk Fonden (грант № NNF17OC0027598).
Дополнительная информация

История публикаций

Получено: 21 августа 2019 г.

Принято после пересмотра: 5 сентября 2019 г.

Дата публикации:
24 сентября 2019 г. (онлайн)


Опубликовано в рамках Специальной секции 11-го подразделения EuCheMS Organic Мастерская юного следователя

Абстрактные

Мы сообщаем о легком синтезе сульфонов, β-кетосульфонов и сульфонамидов из винилсульфонов посредством последовательности присоединения-элиминирования, где образование нуклеофильного сульфинат-иона in situ опосредуется цианидом.Использование винилсульфонов обеспечивает высокую селективность S-алкилирования для получения сульфонов с высокими выходами. В присутствии N-бромсукцинимида первичные и вторичные амины претерпевают образование сульфонамида. Предварительное механистическое исследование показало образование акрилонитрила в качестве невинного побочного продукта без вмешательства в желаемый путь реакции при образовании сульфинатного нуклеофила.

Ключевые слова

цианид — сульфонат — сульфоны — сульфаниламиды — винилсульфоны

Дополнительная информация

    Дополнительная информация для этой статьи доступна в Интернете по адресу https: // doi.org / 10.1055 / s-0039-16

    .

  • Дополнительная информация
  • Ссылки и примечания

    • 1a Ахмад I, Шагуфта Шагуфта. Int. J. Pharm. Pharm. Sci. 2015; 7: 19
    • Альба А.-НР, Компания — X, Риос Р.Chem. Soc. Ред. 2010; 39: 2018
    • 1c Медоуз округ Колумбия, Жервей-Гааг Дж. Med. Res. Ред. 2006; 26: 793
    • Трост Б.М., Kalnmals CA. Chem. Евро. J. 2019; 25: 11193
    • 2a Kupwade RV.J. Chem. Ред.2019; 1: 99
    • 2b Лю Н.-З, Лян С., Маноликакес Г. Синтез 2016; 48: 1939
    • 3a Кайзер Д, Клозе I, Oost R, Neuhaus J, Маулид Н.Chem. Ред.2019; 119: 8701
    • 3b Азиз Дж, Мессауди С, Алами М, Хамзе А. Орг. Biomol. Chem. 2014; 12: 9743
    • 3c Гийон Х, Шашиньон H, Кахард Д.Beilstein J. Org. Chem. 2017; 13: 2764
  • 4 Шьям П.К., Чан Х.-Й. J. Org. Chem. 2017; 82: 1761
    • 5a Рой Т, Ким MJ, Ян Y, Ким С, Кан Г, Рен Х, Кадзиола А, Ли Х.-Y, Байк М.-Х, Ли Дж.-В. ACS Catal. 2019; 9: 6006
    • Джуль М, Ли Дж.-В. Энгью. Chem. Int. Эд. 2018; 57: 12318
  • 6 Киёкава К., Нагата Т, Хаякава Дж. Минаката С.Chem. Евро. J. 2015; 21: 1280
  • 7 Лю Дж, Чжэн Л. Adv. Synth. Катал. 2019; 361: 1710
  • 8 Чжу Дж. Ян В.-К, Ван X.-d, Ву Л. Adv. Synth. Катал. 2018; 360: 386
    • 9a Байдя М, Кобаяши С, Майр Х.Варенье. Chem. Soc. 2010; 132: 4796
    • Джи Й.-Зи, Ли Х.-Дж., Чжан Дж.-Й, У Ю.-К. Евро. J. Org. Chem. 2019; 1846
    • 10a Muneeswara M, Сундаравелу Н, Секар Г.Тетраэдр 2019; 75: 3479
    • 10b Кумар Н, Кумар А. ACS Sustainable Chem. Англ. 2019; 7: 9182
    • 10c Цай С, Чен Д, Сюй Y, Венг В, Ли Л, Чжан Р, Хуанг М.Орг. Biomol. Chem. 2016; 14: 4205
    • 11a Монтгомери Д.И., Коричневый МФ, Рейли У, Цена LM, Абрамит Ж.А., Аркари Дж., Бархам Р., Че Ы, Чен Дж. М., Чанг SW, Коллантес Э.М., Десбонне C, Дороски М, Доти Дж, Энгтракул JJ, Харрис TM, Huband M, Кнафельс JD, Выщелачивание KL, Лю С, Марфат А, Макаллистер Л, МакЭлрой Э, Menard CA, Миттон-Фрай М, Маллинз Л, Ной MC, О’Доннелл Дж., Оливер Р, Penzien J, Пламмер М, Шанмугасундарам V, Тома С, Томарас А.П., Уччелло Д.П., ВАЗ А, Вишка Д.Г.J. Med. Chem. 2012; 55: 1662
    • 11b Аранапакам V, Grosu GT, Дэвис Дж. М., Центр, Эллингбо Дж, Бейкер JL, Скотницкий Ю.С., Заск А, ДиДжозеф Дж. Ф., Сун А, Шарр М.А., Киллар Л.М., Уолтер Т, Джин Джи, Каулинг Р.J. Med. Chem. 2003; 46: 2361
  • 12 Маркитанов Ю.М., Тимошенко В.М., Шермолович Ю.Г. J. Sulphur Chem. 2014; 35: 188
  • 13 Общая методика синтеза сульфонов 2a – m Винилсульфон (0,4 ммоль) и цианид тетраэтиламмония (1,05 экв., 0,42 ммоль) растворяли в DCM (1 мл). Реакционную смесь перемешивали 5 мин, и раствор соответствующего электрофила (1.По каплям добавляли 05 экв., 0,42 ммоль) в DCM (0,5 мл). Полученную реакционную смесь перемешивали при комнатной температуре. После завершения реакции (проверено с помощью неочищенного ЯМР -1, H или ГХ-МС) к реакционной смеси добавляли воду (10 мл) и продукт экстрагировали этилацетатом (3 × 10 мл). Объединенные органические слои промывали рассолом (10 мл), сушили над безводным Na 2 SO 4 и концентрировали под вакуумом. Полученный таким образом сырой продукт очищали колоночной хроматографией, используя 10–20% этилацетат в петролейном эфире.(Бензилсульфонил) бензол (2a) Соединение 2a (87 мг, 94%) синтезировали по общей методике синтеза сульфонов и выделяли в виде белого твердого вещества. 1 H ЯМР (500 МГц, CDCl 3 ): δ = 7,66-7,56 (м, 3 H), 7,47-7,42 (м, 2 H), 7,35-7,29 (м, 1 H), 7,28-7,23 (м, 2 H), 7,13–7,04 (м, 2 H), 4,31 (с, 2 H). 13 C ЯМР (126 МГц, CDCl 3 ): δ = 138,0, 133,8, 131,0, 129,0, 128,9, 128,8, 128,7, 128,3, 63,0. HRMS (EI): вычислено m / z для C 13 H 13 O 2 S [M + H] + : 233.0636; найдено: 233,0636. 1-фенил-2- (фенилсульфонил) этан-1-он (2k) Соединение 2k (96 мг, 92%) синтезировали по общей методике синтеза сульфонов и выделяли в виде белого твердого вещества. 1 H ЯМР (500 МГц, CDCl 3 ): δ = 7,95–7,93 (м, 2 H), 7,91–7,89 (м, 2 H), 7,68–7,60 (м, 2 H), 7,60–7,54 (м, 2 H), 7,50–7,47 (м, 2 H), 4,74 (с, 2 H). 13 C ЯМР (126 МГц, CDCl 3 ): δ = 188,1, 138,9, 135,9, 134,5, 134,4, 129,4, 129,4, 129,0, 128,7, 63,6. HRMS (EI): вычислено m / z для C 14 H 13 O 3 S [M + H] + : 261.0585; найдено: 261,0586.
  • 14 Общая методика синтеза сульфаниламидов 4a – f N-Бромсукцинимид (1,5 эквив., 0,6 ммоль) добавляли по частям во флакон, содержащий раствор соответствующего амина (1,5 экв., 0,6 ммоль) в DCM (1 мл). В другой ампуле винилсульфон (0,4 ммоль) и цианид тетраэтиламмония (1,05 экв., 0,42 ммоль) были взяты вместе с DCM (1 мл) и перемешаны в течение 5 мин. Затем к предыдущей смеси по каплям добавляли последний раствор. Объединенной реакционной смеси давали возможность перемешиваться при комнатной температуре.После завершения реакции (проверено с помощью неочищенного 1 H ЯМР и ТСХ) к реакционной смеси добавляли воду (10 мл) и продукт экстрагировали этилацетатом (3 × 10 мл). Объединенные органические слои промывали рассолом (10 мл), сушили над безводным Na 2 SO 4 и концентрировали под вакуумом. Полученный таким образом сырой продукт очищали колоночной хроматографией, используя 10–20% этилацетат в петролейном эфире. 4- (Фенилсульфонил) морфолин (4a) Соединение 4a (86 мг, 95%) синтезировали по общей методике синтеза сульфонамидов и выделяли в виде белого твердого вещества. 1 H ЯМР (500 МГц, CDCl 3 ): δ = 7,78–7,74 (м, 2 H), 7,66–7,61 (м, 1 H), 7,59–7,54 (м, 2 H), 3,77–3,72 (м, 4 H), 3,03–2,98 (м, 4 H). 13 C ЯМР (126 МГц, CDCl 3 ): δ = 135,3, 133,2, 129,3, 128,0, 66,2, 46,1. HRMS (EI): вычислено m / z для C 10 H 14 NO 3 S [M + H] + : 228,0694; найдено: 228,0693.
    • 15a Ян Х, Сук Охдж, Ли Дж.-W, Песня CE. Nat. Commun. 2012; 3: 1212
    • 15b Парк SY, Лю И, О, JS, Квеон Ю.К., Чон ЙБ, Дуань М, Тан Y, Ли Дж.-W, Ян Х, Песня CE. Chem. Евро. J. 2018; 24: 1020
    • 15c Лю И, Ao J, Палади С, Песня CE, Ян Х. Варенье. Chem. Soc. 2016; 138: 16486

    • Обзор см .:
    • 15д Оливейра М.Т., Ли Дж.-W. ChemCatChem 2017; 9: 377
  • 16 Солнце S, Ю. Ж.-Т, Цзян Y, Ченг Дж. Adv. Synth. Катал. 2015; 357: 2022

Новый антибиотик родомиртон улавливает мембранные белки в везикулах с повышенной текучестью

Образец цитирования: Saeloh D, Tipmanee V, Jim KK, Dekker MP, Bitter W, Voravuthikunchai SP, et al.(2018) Новый антибиотик родомиртон улавливает мембранные белки в везикулах с повышенной текучестью. PLoS Pathog 14 (2): e1006876. https://doi.org/10.1371/journal.ppat.1006876

Редактор: Кимберли А. Клайн, Технологический университет Наньян, СИНГАПУР

Поступила: 27 июня 2017 г .; Одобрена: 12 января 2018 г .; Опубликовано: 16 февраля 2018 г.

Авторские права: © 2018 Saeloh et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

Финансирование: Эта работа финансировалась грантом NWO STW-Vici (№ 12128 для LWH, https://www.nwo.nl/en) и грантом старшего научного сотрудника TRF от Тайского исследовательского фонда (RTA5880005 для SPV). , www.trf.or.th/rus/). DS финансировался Проектом по продвижению исследований в области высшего образования и Национальным исследовательским университетом Таиланда, Офис комиссии по высшему образованию, доктор философии. Стипендия и стипендия для исследования дипломной работы за рубежом, полученная в аспирантуре Университета принца Сонгкла. Электронная микроскопия была выполнена на установке VU / VUmc EM при поддержке Нидерландской организации научных исследований (NWO, middelgroot 009). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и интерпретации данных или в принятии решения о представлении работы для публикации.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Подавляющее большинство антибиотиков, используемых в настоящее время в клинике, получают из микробных источников [1]. Однако растения представляют собой огромный источник мощных биоактивных молекул, а некоторые соединения растительного происхождения обладают многообещающей антибактериальной активностью [2]. Учитывая тревожный рост числа устойчивых к антибиотикам патогенов, крайне важно изучить потенциал противомикробных препаратов из растительных источников для разработки новых антибиотиков [3,4].Одним из таких многообещающих соединений является родомиртон ацилфлороглюцин, выделенный из листьев мирта розового Rhodomyrtus tomentosa [5]. Родомиртон очень активен против широкого спектра грамположительных бактерий, среди которых видов Bacillus , Enterococcus , Staphylococcus и Streptococcus , включая клинические изоляты и мультирезистентные штаммы [5,6], и уничтожает зрелые биопленки Propionibacterium acnes [7], Staphylococcus aureus и Staphylococcus epidermidis [8].Родомиртон обладает бактерицидным действием, и его минимальные ингибирующие концентрации сравнимы с таковыми у антибиотиков последней инстанции ванкомицина и даптомицина [8]. Попытки культивировать устойчивые мутанты в лаборатории не увенчались успехом в экспериментах по множественному пассированию [6]. Важно отметить, что цитотоксических эффектов на фибробласты и эритроциты человека не наблюдалось [6,9]. Родомиртон также не вызывал раздражения кожи при местном применении у кроликов [10], а тесты на острую токсичность не показали побочных эффектов у мышей при введении [11].Кроме того, было доказано, что он эффективен против биопленок Propionibacterium acne [10,12], показал отличные результаты в предотвращении адгезии и инвазии стафилококка на тканевой модели мастита крупного рогатого скота [13], а также предотвращал адгезию стоматологических патогенов к пластиковым поверхностям. и буккальные клетки человека [14].

Несмотря на то, что он является таким многообещающим новым кандидатом в антибиотики, механизм, с помощью которого родомиртон убивает бактерии, еще не изучен. Ранние исследования с использованием Streptococcus mutans , Streptococcus pyogenes и S . aureus не сообщил об отчетливом лизисе клеток или утечке внутриклеточного содержимого, но об усилении основных метаболических путей [5,6,15]. Эти результаты позволили сделать вывод, что родомиртон, вероятно, имеет внутриклеточную мишень. Подход компьютерного докинга идентифицировал дигидрофолатредуктазу DfrA как потенциальную мишень, но это не могло быть экспериментально подтверждено [16]. В том же исследовании также было обнаружено возможное взаимодействие родомиртона с незаменимым белком деления клеток FtsZ, а более раннее протеомное исследование показало снижение уровней FtsZ и изменения размера, формы и образования перегородки у клеток S , обработанных родомиртоном. aureus [17]. Однако недавнее исследование показало, что родомиртон не может специфически ингибировать B . subtilis Полимеризация FtsZ in vivo , но скорее влияет на несколько различных белков деления клеток [18].

Из-за этих противоречивых наблюдений мы более тщательно исследовали влияние родомиртона на оболочку бактериальных клеток, используя недавно разработанный подход, основанный на клеточной биологии, для изучения механизма действия антибактериальных соединений [19,20].Используя флуоресцентный свет и микроскопию высокого разрешения, а также специальные мембранные красители, методы in vitro и молекулярное моделирование, мы обнаружили, что родомиртон в первую очередь действует на клеточную мембрану, но неожиданным образом. Родомиртон вызывает драматические инвагинации мембран, в результате чего образуются внутриклеточные пузырьки, которые привлекают и улавливают различные мембранные белки. Эти структуры также привлекают липиды гибких мембран, что приводит к образованию очень жидких (неупорядоченных по жидкости) мембранных доменов и последующей жесткости (упорядоченной по жидкости) остальной мембраны, что приводит к дальнейшей делокализации периферических мембранных белков.Эти мембранные искажения нарушают многие важные процессы, связанные с мембраной, включая дыхание и синтез АТФ. Моделирование молекулярной динамики показало, что родомиртон осуществляет ремоделирование мембраны путем временного взаимодействия с головными группами фосфолипидов, таким образом, без интеграции в липидный бислой. Такой молекулярный механизм ранее не наблюдался для каких-либо противомикробных препаратов, нацеленных на мембрану, и это объясняет, почему долгое время считалось, что родомиртон не нацелен на клеточную оболочку.

Результаты

Бактериальное цитологическое исследование

Предыдущие исследования показали, что родомиртон может ингибировать внутриклеточные процессы [5,16,21]. Чтобы исследовать это дальше, мы использовали недавно разработанный анализ, который использует делокализацию маркерных белков для идентификации клеточного процесса, на который нацелено противомикробное соединение [19]. Этот метод также известен как бактериальное цитологическое профилирование [22,23]. Во-первых, мы изучили, вызывает ли родомиртон повреждение ДНК или ингибирует репликацию ДНК, РНК или синтез белка.С этой целью соответствующие ферменты были помечены GFP, и их клеточная локализация контролировалась с помощью флуоресцентной световой микроскопии (рис. 1, список штаммов см. В таблице S1). Изменение локализации RecA (фермента репарации ДНК), DnaN (субъединица ДНК-полимеразы), RpoC (субъединица РНК-полимеразы) и RpsB (субъединица рибосомы) указывает на повреждение ДНК, ингибирование репликации ДНК, синтеза РНК и белка. синтез соответственно (S1 фиг.). Как показано на фиг. 1, родомиртон не повлиял на клеточную локализацию ни одного из этих белков, что указывает на то, что соединение не ингибирует ни один из этих внутриклеточных процессов.

Рис. 1. Локализация внутриклеточных репортерных белков.

Б . subtilis штамм HM771 ( dnaN-gfp , репортер нарушенной репликации), штамм UG-10 ( recA-gfp , репортер повреждения ДНК), штамм 1048 ( rpoC-gfp , репортер нарушенного синтеза РНК) и штамм 1049 ( rpsB-gfp , репортер нарушенного синтеза белка) выращивали до OD 600 0,3 и затем обрабатывали 1x MIC родомиртона.Шкала 2 мкм.

https://doi.org/10.1371/journal.ppat.1006876.g001

Родомиртон делокализует мембранные белки

Предыдущие исследования показали, что родомиртон вызывает деформации формы клеток и лизис клеток [17,18], предполагая, что соединение может воздействовать на оболочку бактериальных клеток. Чтобы изучить это более внимательно, мы наблюдали за локализацией репрезентативного набора периферических мембранных белков, которые использовались для изучения эффектов мембранно-активных антибиотиков [19,24,25]: (i) белки деления клеток FtsA, DivIVA, и MinD, (ii) фосфолипидсинтаза PlsX, (iii) белок MreB, определяющий форму клетки, (iv) белок синтеза клеточной стенки MurG и (v) сукцинатдегидрогеназа SdhA, которая является частью дыхательной цепи.Все белки демонстрировали паттерны аберрантной локализации после 10 мин лечения, которые усугублялись при продолжении лечения в течение 30 мин (рис. 2А). DivIVA, MinD, PlsX, MreB и MurG накапливались в больших флуоресцентных фокусах, в то время как FtsA и SdhA полностью отделялись от мембраны. Эти изменения наблюдались почти во всех клетках (см. Рис. S2 и S3 для обзорных изображений GFP-MreB). Чтобы проверить, насколько быстро происходят эти изменения, мы выбрали DivIVA для временного эксперимента. Как показано на Рис. 2B и S1 Movie, делокализация DivIVA была видна уже через 2 мин.Таким образом, родомиртон быстро влияет на множество мембраносвязанных процессов.

Рис. 2. Локализация B . subtilis мембранных белков после обработки родомиртоном.

(А) В . Штаммы subtilis (подробную информацию см. В таблице S1) выращивали до OD 600 0,3 и затем обрабатывали родомиртоном (1x MIC). См. Также обзорные изображения GFP-MreB на рис. S2 и S3. (B) Покадровая микроскопия DivIVA-GFP. В . subtilis Штамм HS63 помещали на агарозный пластырь и помещали в проточную камеру. Постоянный поток среды обеспечивал поступление достаточного количества питательных веществ и кислорода во время эксперимента. Родомиртон добавляли со средней скоростью, и снимки делали каждые 2 мин. См. Также фильм S1. Шкала 2 мкм.

https://doi.org/10.1371/journal.ppat.1006876.g002

Целостность клеточной стенки

Несколько исследований показали, что лечение родомиртоном приводит к деформации формы клеток и некоторой степени лизиса клеток [17,18], что хорошо согласуется с нашим наблюдением, что локализация MurG, фермента, участвующего в синтезе липида-предшественника клеточной стенки II , был затронут родомиртоном (рис. 2А).Однако при 1x MIC мы не наблюдали лизиса на основании измерений оптической плотности (OD), а 2x MIC приводили только к постепенному снижению OD (рис. 3A). Чтобы проверить, влияет ли родомиртон на целостность клеточной стенки, мы использовали метод микроскопической фиксации для визуализации повреждений клеточной стенки [26]. Как показано на рис. 3B, родомиртон не оказывал немедленного воздействия на целостность клеточной стенки, что резко контрастировало с антимикробными пептидами даптомицином, грамицидином S и MP196, которые все мешают синтезу липида II [19,27] .Таким образом, синтез клеточной стенки, по-видимому, не является основной мишенью родомиртона.

Рис. 3. Воздействие родомиртона на клеточную оболочку B . subtilis .

(A) Влияние родомиртона на рост B . subtilis . Стрелка отмечает момент добавления антибиотика. (B) Влияние родомиртона на синтез клеточной стенки. В . subtilis обрабатывали 0,5 мкг / мл (1x MIC) или 1 мкг / мл (2x MIC) родомиртона (Rho), 1 мкг / мл грамицидина S (GraS), 2 мкг / мл даптомицина (Dap) или 10 мкг / мл MP196 в течение 15 мин, а затем фиксировали в смеси 1: 3 уксусной кислоты и метанола.Нарушение синтеза липида II приводит к вытеснению клеточной мембраны через отверстия в клеточной стенке. Даптомицин, грамицидин S и MP196, все из которых ингибируют синтез липида II, вмешиваясь в белки синтеза клеточной стенки на мембране, служили в качестве положительного контроля. Шкала 2 мкм. (C) Мембранный потенциал, измеренный с помощью флуоресцентного красителя DiSC (3) 5. Стрелка указывает момент добавления антибиотика. (D) Окрашивание йодидом пропидия. Флуоресцентный краситель указывает на наличие крупных мембранных пор или серьезное разрушение мембраны.Детергент SDS, который вызывает поры за счет образования мицелл мембраны, использовали в качестве положительного контроля. Планки погрешностей представляют собой стандартную ошибку среднего (SEM) трех биологических повторов. (E) Отток ионов калия, измеренный с помощью внутриклеточного калий-селективного флуоресцентного красителя APG-2. В . subtilis 168 окрашивали APG-2 в течение 1 ч перед добавлением антибиотика (стрелка). Грамицидин ионофора канала K + / Na + служил в качестве положительного контроля. (F) Активность дыхательной цепи, измеренная по восстановлению резазурина до резофурина. CCCP и NaN 3 использовали в качестве положительного контроля. CCCP отделяет дыхательную цепь от протонного градиента, а NaN 3 является ингибитором оксидазы цитохрома c (комплекс IV дыхательной цепи). Планки погрешностей представляют собой стандартное отклонение среднего значения трех биологических повторов. Обратите внимание на разные шкалы времени в (A), (C) и (E).

https: // doi.org / 10.1371 / journal.ppat.1006876.g003

Функция мембранного барьера

Ранее мы показали, что локализация нескольких периферических мембранных белков, включая MinD и FtsA, зависит от мембранного потенциала, поскольку прикрепление их нацеленных на мембрану амфипатических спиралей к клеточной мембране сильно стимулируется разностью электрических потенциалов на мембрана [24]. Поскольку мы наблюдали делокализацию ряда периферических мембранных белков (Рис. 2), среди которых MinD и FtsA, мы исследовали, рассеивает ли родомиртон мембранный потенциал, используя мембранно-потенциометрический зонд DiSC (3) 5 [28] (Рис. 3C).Действительно, клетки деполяризовались примерно за 3 мин. Это было не так быстро и сильно, как деполяризация, которая происходит с антибиотическим пептидом грамицидином, который формирует канал K + / Na + в мембране [29] (рис. 3C), что позволяет предположить, что родомиртон не образует ионный канал. ни поры мембраны. Последнее было подтверждено с помощью иодида пропидия (PI), флуоресцентного индикатора, который проникает в клетки через поры или серьезные повреждения мембраны [30]. Как показано на фиг. 3D, значительного притока ИП не наблюдалось даже после 30-минутной обработки 4-кратным МПК.

Чтобы проверить, увеличивает ли родомиртон ионную проницаемость мембраны, мы измерили внутриклеточные концентрации калия с помощью калий-селективного флуоресцентного зонда APG-2 в течение 20 минут (рис. 3E). Действительно, родомиртон вызывал непрерывную утечку калия в зависимости от концентрации. Однако эта утечка происходила слишком медленно (10–30 мин), чтобы объяснить гораздо более быструю (3 мин) деполяризацию мембраны (рис. 3C). Кроме того, при 1x MIC клетки восстанавливали свои уровни калия примерно через 20 минут (фиг. 3E), но не их мембранный потенциал (S4, фиг.).

Деполяризация может быть вызвана не только проницаемостью мембраны, но и нарушением цепи переноса электронов, которая генерирует протонный градиент [27]. Фактически, рис. 2A показывает, что сукцинатдегидрогеназа (SdhA), которая направляет протоны из цикла TCA в цепь переноса электронов [31], полностью отделяется от мембраны, когда клетки инкубируются с родомиртоном. Важно отметить, что мы показали в предыдущей работе, что этот белок не делокализируется, когда движущая сила протона рассеивается [25].Таким образом, делокализация SdhA не является общим эффектом деполяризации мембраны, а специфична для лечения родомиртоном. Чтобы оценить, действительно ли родомиртон влияет на активность дыхательной цепи, мы измерили скорость восстановления резазурина, который обычно используется для измерения восстановительной способности клеток [19,32]. Действительно, инкубация с родомиртоном значительно снижает восстановительную способность B . subtilis клеток, что свидетельствует о сильном ингибировании цепи переноса электронов (рис. 3F).Этот эффект был сравним с эффектом протонного ионофора карбонилцианида м-хлорфенилгидразона (CCCP), разобщителя цепи переноса электронов, и намного сильнее, чем у азида натрия, который ингибирует комплекс IV дыхательной цепи (рис. 3F). . Таким образом, родомиртон влияет как на поддержание, так и на генерацию движущей силы протона.

Родомиртон влияет на липидные домены

Хотя наши результаты показали, что родомиртон влияет на различные мембранные функции, до сих пор неясно, как соединение достигает этих мембранных эффектов.Чтобы пролить свет на его молекулярный механизм, мы сначала исследовали влияние родомиртона на мембранную организацию с использованием флуоресцентного мембранного красителя FM5-95. Добавление соединения вызывало высоко флуоресцентные мембранные очаги почти в 90% клеток (рис. 4A и 4B, см. Рис. S5 и S6 для обзорных изображений), в то время как оно не влияло на нуклеоид (рис. 4A, см. Рис. S7 и S8 для обзора). картинки). Такие аберрантные мембранные пятна также наблюдались, когда мембранный потенциал рассеивался с помощью CCCP, что было приписано накоплению очень гибких липидов [25].Высокая концентрация таких гибких липидов, то есть липидов с короткими, разветвленными и / или ненасыщенными цепями жирных кислот, увеличивает локальную текучесть мембран (жидкое неупорядоченное состояние) и, таким образом, облегчает введение флуоресцентных мембранных зондов и / или увеличивает квантовый выход их флуоресценции. что приводит к сильному усилению сигналов флуоресценции [19,25,33]. Логарифмически растёт B . Клетки subtilis , такие гибкие липиды, будут формировать микроскопически видимые жидкие микродомены (S9 фиг.), Стимулированные гомологом актина MreB [24].Эти области повышенной текучести (RIF) могут быть окрашены флуоресцентным липид-имитирующим красителем DiIC12, который имеет сильное предпочтение для жидких мембранных доменов из-за его короткой ацильной цепи [25]. Когда окрашенные DiIC12 клетки обрабатывали родомиртоном, регулярно распределенные RIF быстро разрушались в большие фокусы (рис. 4C), указывая на то, что сильно флуоресцентные участки FM5-95 действительно обогащены липидами гибких мембран. Количественная оценка количества фокусов DiIC12 на клетку показала четкое сокращение множества RIF до одного или нескольких крупных жидких липидных фокусов, окрашенных DiIC12 на клетку (рис. 4D, см. Рис. S10 и S11 для обзорных изображений), что позволяет предположить, что RIF могут сливаться вместе в генерируют эти домены, идея, которая была подтверждена покадровой микроскопией (рис. 4E).

Рис. 4. Родомиртон (Rho) вызывает аберрантное флуоресцентное окрашивание мембран.

(А) В . subtilis 168 окрашивали мембранным красителем FM5-95 и ДНК-красителем DAPI. Синие стрелки указывают на участки на мембране, индуцированные родомиртоном. (B) Количественная оценка клеток, показывающих пятна мембраны, окрашенные FM5-95, в необработанных (зеленый, n = 311) и обработанных родомиртоном (синий, n = 351) клетках. См. Также обзорные микроскопические изображения на S7 и S8 рис.). (К) В . subtilis 168 окрашен жидким липидным красителем DiIC12. Природные RIF отмечены желтыми стрелками, индуцированные родомиртоном накопления жидких липидов — синими стрелками. (D) Количественная оценка мембранных очагов на клетки в необработанных (зеленый, n = 91) и обработанных родомиртоном (синий, n = 93) клетках. См. Также обзорные микроскопические изображения на рис. S10 и S11. (E) Покадровая микроскопия, показывающая слияние нативных RIF в большие скопления жидких липидов. (F) FM5-95 краситель B . subtilis штамм 4277 ( ΔmreB Δmbl ΔmreBH ). Синие стрелки указывают на участки на мембране, индуцированные родомиртоном. Шкала 2 мкм.

https://doi.org/10.1371/journal.ppat.1006876.g004

RIF образуются прикрепленными к мембране полимерами MreB по еще неизвестному механизму [25,34]. Поскольку MreB был делокализован соединением (рис. 2A), мы проверили, требуется ли для индуцированного родомиртоном кластеризации RIFs MreB или один из его гомологов (Mbl, MreBH), используя мутант с делецией ΔmreB Δmbl ΔmreBH .Этот мутант образует круглые клетки, поскольку в нем отсутствует продольная организация синтеза пептидогликана [35]. Как показано на фиг. 4F, родомиртон все еще способен вызывать флуоресцентные мембранные очаги, демонстрируя, что для этого не требуется MreB.

Влияние на текучесть мембраны

Чтобы определить, влияет ли кластеризация гибких (= псевдоожижающих) липидов на общую текучесть мембран, мы использовали зонд поляризации флуоресценции лаурдан, который изменяет свои флуоресцентные свойства в зависимости от распределения головной группы и гибкости цепи жирных кислот [36].Добавление родомиртона привело к быстрому (2 мин), зависящему от концентрации снижению генерализованной поляризации лаурдана (GP), что свидетельствует об увеличении текучести мембраны (рис. 5A), как видно из положительного контроля, известной мембраны. флюидизатор бензиловый спирт [37].

Рис. 5. Родомиртон вызывает очень жидкие мембранные домены.

(A) Текучесть мембраны B . subtilis 168, обработанные различными концентрациями родомиртона, измеренными с помощью генерализованной поляризации лаурдана (лаурдан GP, по шкале от -1 (очень жидкая) до 1 (очень жесткая)).Бензиловый спирт служил контролем для псевдоожижения. (B) Laurdan GP микроскопия B . subtilis 168. Клетки обрабатывали 1x MIC родомиртона в течение 10 минут. Стрелки указывают на участки жидкой мембраны. Шкала 2 мкм. Прямоугольники представляют области, увеличенные в (C). (C) Упрочнение остальной мембраны. Стрелки указывают положение клеточной мембраны. На левой панели показан увеличенный вырез из (B) с той же цветовой шкалой. Правые панели показывают изображение ложного цвета, изображающее лаурдановое изображение GP в сером цвете и флуоресцентное пятно лаурдана (460 нм) в красном, чтобы визуализировать положение плазматической мембраны (подробности расчета GP по изображениям см. В Материалах и методах).GP изменяется с зеленого (GP ~ 0,3) на белый (GP ~ 0,5), показывая жесткость мембраны. (D) Количественная оценка текучести мембран в отдельных участках мембраны и в остальных мембранах клеток, окрашенных лаурданом. 100 мкМ CCCP использовали в качестве положительного контроля. (E) Адаптация жирных кислот B . subtilis после одного времени удвоения под воздействием субингибирующих концентраций (0,25 мкг / мл, 0,5x МИК) родомиртона. Эта концентрация была выбрана на основе эффекта роста культур, обработанных родомиртоном, в больших культуральных колбах (см. S15, фиг.).Планки погрешностей представляют собой стандартную ошибку среднего значения двух биологически независимых повторных экспериментов.

https://doi.org/10.1371/journal.ppat.1006876.g005

Чтобы изучить, как изменяется текучесть на уровне отдельных клеток, мы использовали лаурдановую микроскопию (рис. 5B – 5D). В соответствии с очаговым обогащением гибких липидов, были очевидны мембранные очаги сильно увеличенной текучести, а остальная часть клеточной мембраны демонстрировала явное снижение текучести (жидкостное упорядоченное состояние).Таким образом, общее увеличение текучести мембраны, наблюдаемое на фиг. 5A, вызвано сильно текучими мембранными фокусами в клетке. Этот эффект усиливается накоплением лаурдана в этих областях жидкой мембраны (рис. 5B), что приводит к более высокой интенсивности сигнала в этих областях (S12, рис.). Интересно, что когда мы сравнивали участки жидкой мембраны, образованные родомиртоном, с участками жидкого липида, образованными CCCP, мы обнаружили, что родомиртон оказывает значительно более сильный местный псевдоожижающий эффект (рис. 5D), подтверждая мнение о том, что пятна, вызванные родомиртоном, принципиально отличаются от жидких. липидные кластеры, образованные CCCP посредством делокализации MreB [25].

Чтобы показать, что влияние родомиртона на текучесть мембран — это не просто эффект ингибирования роста, мы обрабатывали клетки ципрофлоксацином, который не нацелен на бактериальную мембрану, но убивает бактерии, ингибируя синтез ДНК. Инкубация B . Клетки subtilis в течение 10 мин с летальными концентрациями ципрофлоксацина не влияли на общую текучесть мембран и не приводили к образованию прозрачных жидких очагов мембран (S13, фиг.).

Если псевдоожижение фокальной мембраны действительно является ключевой особенностью активности родомиртона, вполне вероятно, что бактерии попытаются изменить свой состав жирных кислот, чтобы компенсировать эти изменения.Действительно, когда клетки инкубировали с субингибирующими концентрациями родомиртона, клетки показали значительное уменьшение короткоцепочечных жирных кислот в пользу длинноцепочечных жирных кислот, что повысит жесткость мембран (рис. 5E и таблицы S2 и S3). Следует отметить, что мы не наблюдали изменений в соотношении iso- к anteiso -разветвленных жирных кислот или насыщенных к ненасыщенным жирным кислотам, которые являются основной стратегией адаптации B . subtilis в ответ на физические изменения текучести мембран [38,39].Начиная с B . subtilis приспосабливает свой состав жирных кислот к более высокой жесткости мембраны, похоже, что сильная фокальная псевдоожижение мембраны является основной проблемой для клеток, а не жесткостью остальной клеточной мембраны.

Мембранные инвагинации

В предыдущих исследованиях мы показали, что высоко флуоресцентные мембранные пятна, которые образуются, когда клетки обрабатываются лекарствами, рассеивающими мембранный потенциал, не являются следствием накопления дополнительного мембранного материала, например.г. из-за инвагинации мембраны [25]. Это было доказано, показывая, что локализация трансмембранной АТФ-синтазы FoF1 оставалась неизменной и что не было накопления этого белка в областях, которые демонстрировали сильную флуоресценцию мембранных красителей. Поэтому было замечательно, что, когда мы повторили этот эксперимент с родомиртоном, AtpA, субъединица комплекса АТФ-синтазы FoF1, стала делокализованной и накапливалась в очагах, когда клетки обрабатывали родомиртоном (Рис. 6A, S14 Рис.), Что позволяет предположить, что соединение действительно действительно приводят к инвагинациям мембран.Чтобы проверить это, мы использовали микроскопию со структурированным освещением (SIM) сверхвысокого разрешения. Клеточные мембраны были окрашены зеленым митотрекером, который обеспечивает отличный контраст SIM и оптимальное разрешение мембранных структур. После 10 мин инкубации с родомиртоном стали четко видны мембранные инвагинации и большие внутриклеточные везикулы (рис. 6В). Поскольку реконструкция изображения SIM иногда может приводить к визуальным артефактам [40], мы подтвердили наличие инвагинаций мембраны с помощью B . subtilis , экспрессирующий цитозольный GFP с сильного рибосомного промотора PrpsD (рис. 6С) [40]. В самом деле, в крупных пузырьковых структурах (желтые стрелки) отсутствует GFP, что указывает на то, что они происходят из инвагинаций клеточных мембран. Некоторые из более мелких мембранных инвагинаций (синие стрелки) четко не показывают смещенный сигнал GFP, что может иметь место, когда их внутренний объем ниже разрешения SIM. SIM-микроскопия окрашенных DiIC12 клеток подтвердила, что инвагинации накапливали жидкий мембранный зонд DiIC12, как и ожидалось (фиг. 6D).

Рис. 6. Родомиртон вызывает инвагинации мембран.

(A) Делокализация AtpA-GFP. (B) SIM-изображения B . subtilis 168 клеток, окрашенных митотрекерным зеленым (MTG), обработанных родомиртоном 1x MIC в течение 10 мин (нижняя панель, необработанные клетки на верхней панели). (C) SIM-изображения B . subtilis штамм bSS82, экспрессирующий цитозольный GFP из сильного рибосомного промотора PrpsD , окрашенный нильским красным.На верхних панелях показаны необработанные клетки, на нижних панелях показаны клетки, обработанные родомиртоном 1x MIC в течение 10 мин. Отсутствие зеленого сигнала флуоресценции указывает на наличие крупных мембранных инвагинаций (желтые стрелки). Синие стрелки указывают на небольшие мембранные впячивания. (D) SIM-изображения B . subtilis 168, окрашенный DiIC12. Обратите внимание, что DiIC12 четко окрашивает индуцированные родомиртоном мембранные инвагинации (желтые стрелки). Нативные RIF появляются только в виде небольших очагов повышенной флуоресценции (зеленые стрелки), но не в виде инвагинаций или интенсивных пятен в необработанных клетках.Шкала 2 мкм. (E) ТЕМ-изображения B . subtilis 168, обработанные родомиртоном 1x MIC в течение 10 мин. (i) необработанная контрольная клетка, (ii) репрезентативная клетка, обработанная родомиртоном. Желтая стрелка указывает на крупные внутриклеточные мембранные везикулы, синие стрелки указывают на мелкие мембранные везикулы. (iii-vi) Детали клеток, обработанных родомиртоном. Мембранные везикулы и / или инвагинации имели место во всех продольно разрезанных клетках, которые наблюдались в образцах, обработанных родомиртоном, в то время как необработанные клетки, которые мы наблюдали, никогда не демонстрировали этих деформаций (n ≥ 20).Шкала 0,5 мкм.

https://doi.org/10.1371/journal.ppat.1006876.g006

Чтобы подтвердить образование пузырьков внутренней мембраны родомиртоном с помощью независимого метода, мы провели просвечивающую электронную микроскопию (ПЭМ) (рис. 6E). В соответствии с данными SIM, мы наблюдали большие внутриклеточные мембранные структуры, некоторые из которых были заполнены (рис. 6Eiii и 6Ev), а другие лишены цитозольного материала (рис. 6Eiv и 6Evi), а также более мелкие мембранные везикулы (рис. 6Eiii и 6Eiv). .

Подобные мембранные инвагинации наблюдались после сверхэкспрессии acetyl-CoA carboxylase AccABCD, фермента, катализирующего лимитирующую стадию синтеза жирных кислот [41,42]. Однако для образования инвагинаций значительного размера требуется несколько часов сверхэкспрессии AccABCD [42], тогда как родомиртон уже вызывает большие инвагинации мембран уже через 2–10 мин лечения. Более того, ингибирование синтеза белка и липидов хлорамфениколом и триклозаном, соответственно, не предотвращало образование инвагинаций под действием родомиртона (S15 фиг.), Что дополнительно указывает на то, что соединение непосредственно отвечает за инвагинации мембран.

Улавливающие мембранные белки

Поскольку AtpA, наш репортер инвагинации мембран, накапливался в фокусах (рис. 6A), а участки мембраны, индуцированные родомиртоном (= инвагинации), были обогащены флюидизирующими липидами (рис. 4C-4E), мы задавались вопросом, могут ли эти жидкие мембранные структуры привлекать мембранные белки в целом, что привело к неоднородным паттернам локализации GFP, наблюдаемым на рис. 2. Чтобы изучить это, мы окрашивали клетки, экспрессирующие GFP-меченые периферические мембранные белки, и клетки, экспрессирующие интегральные мембранные белки с GFP, вместе с жидким красителем липидного домена DiIC12 .Как показано на фиг. 7A, все протестированные белки периферической мембраны показали четкое накопление в ярких пятнах DiIC12. Важно отметить, что фиг. 7B показывает, что также трансмембранные белки MraY и PBP2B, участвующие в биосинтезе клеточной стенки, и фосфолипидсинтаза PgsA накапливаются в индуцированных родомиртоном жидких липидных кластерах. Мы выбрали MreB в качестве примерного белка для эксперимента с интервалом времени, чтобы проследить локализацию белка во время генерации жидких липидных кластеров (рис. 7C). Накопление MreB четко коррелировало с образованием доменов, окрашенных DiIC12 (стрелки на фиг. 7A), и там сохранялось.Вместе эти результаты показывают, что как периферические, так и интегральные мембранные белки привлекаются жидкими мембранными доменами и затем захватываются образующимися мембранными пузырьками, вызванными родомиртоном (см. S16 Рис. Для трансмембранного белка MraY). Эти мембранные домены были стабильными. Клетки не смогли ни удалить эти мембранные структуры и восстановить нормальную морфологию мембран (рис. 4C), ни восстановить нормальные паттерны локализации белка (пример MraY на рис. S16) в течение периода времени, наблюдаемого в этом исследовании (60–90 мин). .Ясно, что это улавливание мембранных белков в везикулах сильно ухудшает их функцию и объясняет сильный антимикробный эффект родомиртона.

Рис. 7.

Совместная локализация делокализованных периферических (A) и интегральных (B) мембранных белков с жидкими скоплениями липидов. В . Штаммы subtilis (подробную информацию см. В таблице S1) обрабатывали 1х МИК родомиртона в течение 10 мин. Мембраны окрашивали жидким красителем липидного домена DiIC12. (C) Покадровая микроскопия окрашенных DiIC12 клеток, экспрессирующих GFP-MreB, обработанных родомиртоном 1xMIC. Несколько скоплений жидких липидов и соответствующие скопления MreB показаны стрелками. Шкала 2 мкм.

https://doi.org/10.1371/journal.ppat.1006876.g007

Моделирование молекулярной динамики

Структурно родомиртон не похож на типичный мембранно-интегрирующий агент. Хотя он действительно содержит как полярные, так и неполярные группы, они распределены по молекуле и не определяют отчетливую амфипатичность (рис. 8А), как это обычно имеет место для антимикробных средств, интегрирующих мембрану [43].Таким образом, казалось маловероятным, что соединение внедряется между фосфолипидами. Чтобы понять, как родомиртон может взаимодействовать с фосфолипидами и влиять на них, мы провели моделирование молекулярной динамики с использованием смеси 3: 1 1-пальмитоил-2-олеоилпосфатидилглицерина (POPG) и 1-пальмитоил-2-олеоилфосфатидилэтаноламина (POPE), что имитирует мембрану грамположительных клеток. Как и ожидалось, родомиртон не смог проникнуть в липидный бислой. Вместо этого он временно присоединяется к головным группам фосфолипидов (фиг. 8B и 8C), что приводит к повторяющимся событиям связывания и высвобождения (S2 Movie).В этом связывании участвуют как полярные, так и неполярные остатки антибиотика, но не происходит какой-либо селективности ни в отношении PG, ни в отношении PE (рис. 8C, таблица S4). Связывание родомиртона с головными группами фосфолипидов влияло на вертикальное расположение фосфолипидного бислоя за счет временного вытягивания липидов из мембраны (рис. 8C), что приводило к более плотной упаковке головной группы (рис. 8D) и перегруппировке связанных липидов в листке наружной мембраны (рис. 8C). Рис. 8E и 8F). Эти изменения в наружной створке также влияют на упаковку липидов во внутренней створке с точки зрения распределения цепей жирных кислот, способствуя локальному усилению нарушения мембран (Рис. 8D-8F), что может объяснить разжижающий эффект родомиртона.Чтобы выяснить, проявляют ли повышенные концентрации молекул родомиртона другой эффект, мы также провели моделирование молекулярной динамики с двумя, четырьмя и восемью молекулами родомиртона. Несмотря на то, что молекулы родомиртона имеют тенденцию к формированию кластеров, эффекты на упаковку липидов были аналогичными (S17, рис.).

Рис. 8. Моделирование молекулярной динамики связывания родомиртона с бислоями 3: 1 POPG / POPE (100 нс).

(А) Структура родомиртона. Полярные остатки отображаются синим цветом, неполярные остатки — красным. (B) Состояние мембраны до связывания родомиртона (оранжевый). (C) POPE (зеленый) и POPG (синий) вытягиваются из бислоя родомиртоном. (D) Соединение вызывает более плотную упаковку группы головок в створке наружной мембраны, способствуя более широкому распространению жирных кислот во внутренней створке (стрелки), что приводит к более высокой текучести мембраны. (E-F) Связывание родомиртона с головными липидными группами влияет на расположение цепей жирных кислот внутри бислоя.Перестройка липидов, связанных родомиртоном (синий), также влияет на упаковку цепи жирных кислот во внутренней створке (стрелки).

https://doi.org/10.1371/journal.ppat.1006876.g008

Общий эффект липидного бислоя

Вместе с нашими данными in vivo , моделирование молекулярной динамики показало, что родомиртон является первой мембрано-активной молекулой антибиотика, которая не интегрируется в липидный бислой и вызывает серьезные дефекты упаковки липидов исключительно за счет взаимодействия с головными группами фосфолипидов.Моделирование молекулярной динамики показало временное взаимодействие между головными группами родомиртона и фосфолипидов, что предполагает возможность удаления соединения промыванием. Действительно, когда мы лечили B . subtilis с 1x MIC родомиртона в течение 2 минут, клетки полностью восстановились от деформаций мембраны, когда они были промыты и далее выращены в свежей среде (S18 фиг.). В этом заключается отличие от интеркалирующего мембраны антибиотика даптомицина, который не вымывается [19].Клетки, обработанные более высокими концентрациями родомиртона или инкубированные более 2 минут, не смогли восстановиться, вероятно, из-за непоправимого повреждения мембраны, что хорошо согласуется с образованием необратимых мембранных инвагинаций.

Моделирование молекулярной динамики также показало, что родомиртон не проявляет селективности в отношении липидов PG или PE. Чтобы проверить этот in vivo , мы проверили, играет ли состав головной липидной группы роль в активности родомиртона, используя B . subtilis Мутанты лишены кардиолипина, фосфатидилэтаноламина (PE), лизил-фосфатидилглицерина (L-PG) или обеднены фосфатидилглицерином (PG), четырьмя основными видами фосфолипидов в бактериях. Если родомиртон предпочтительно связывается с одним из этих видов фосфолипидов, он должен быть менее активен против дефицитного штамма. В качестве положительного контроля мы протестировали даптомицин, который менее эффективен против штаммов, истощенных по его докинг-молекуле PG [44–46]. В то время как MIC даптомицина действительно удваивалась для PG-истощенных клеток, ни одна из протестированных мутаций не снижала активность родомиртона (фиг. 9A).Это подтверждает результаты молекулярной динамики, предполагающие, что родомиртон не отдает предпочтения определенному типу головной липидной группы. Следует отметить, что для штамма, обедненного PG, наблюдалась слегка повышенная активность родомиртона, что можно интерпретировать как тормозящий эффект на действие родомиртона PG. Однако ранее было показано, что истощение PG приводит к серьезным дефектам роста и морфологическим изменениям [25], а более низкий MIC, вероятно, является следствием снижения общей пригодности PG-истощенных клеток.Чтобы доказать это, мы определили MIC нескольких других антибиотиков с разными мишенями и действительно обнаружили, что PG-истощенные клетки были более чувствительны ко всем из них (таблица S5).

Рис. 9. Родомиртон действует непосредственно на липидный бислой без особого предпочтения головной группы.

(A) Минимальные ингибирующие концентрации (мкг / мл) родомиртона против различных мутантов головной липидной группы B . subtilis . Даптомицин использовали в качестве контроля. (B) Лаурдановая ГП-спектроскопия липосом, полученных из E . coli полярный липидный экстракт, подвергшийся воздействию различных концентраций родомиртона. Соотношения соединения и липидов: 1 мкг / мл = 1: 400, 10 мкг / мл = 1:40, 50 мкг / мл = 1: 7. (C) Лаурдановая спектроскопия липосом, обработанных бензиловым спиртом, псевдоожижающим мембрану. Соотношения соединения и липидов: 10 мМ = 12,5: 1, 30 мМ = 37,5: 1, 50 мМ = 62,5: 1. (D) SIM-микроскопические изображения липосом, полученные из E . coli полярный липидный экстракт, подвергнутый воздействию различных концентраций родомиртона в течение 5 мин.Липосомы окрашивали DiIC12. Соотношения соединения и липидов как в (B) . Верхний и нижний ряды показывают два примера из одних и тех же образцов. Масштабная линейка 1 мкм. (E) Диаметр липосом из (D i) и (D ii) . Черные полосы представляют собой среднее значение с SEM.

https://doi.org/10.1371/journal.ppat.1006876.g009

Наши модели молекулярной динамики показали, что липиды мембран являются прямой мишенью родомиртона. Чтобы подтвердить это, мы выполнили эксперимент in vitro с лаурданом GP с использованием липосом, приготовленных из полярного липидного экстракта Escherichia coli .Бензиловый спирт, который оказывает прямое разжижающее действие на липидные мембраны [47–49], был использован в качестве положительного контроля (рис. 9B). Как показано на фиг. 9C, добавление родомиртона вызывало явное снижение уровня лаурдана GP при концентрациях, которые примерно соответствуют расчетному соотношению соединения и липидов в наших экспериментах in vivo (1:20, дальнейшие комментарии в разделе «Метод»). Таким образом, псевдоожижение мембраны является прямым действием родомиртона на фосфолипидный бислой и не требует белковой мишени.

Моделирование молекулярной динамики также показало, что родомиртон индуцирует более плотную упаковку головной группы в листке наружной мембраны (рис. 8D), что может приводить к изгибу мембраны и индукции инвагинаций мембраны. Чтобы проверить, способен ли родомиртон изгибать мембраны, мы проанализировали форму липосом, обработанных родомиртоном, с помощью SIM-микроскопии. При низких концентрациях родомиртона липосомы становились намного меньше, чем в необработанном контрольном образце (рис. 9D и 9E), что указывает на ремоделирование мембран и образование пузырьков [50,51].Более высокие концентрации привели к серьезной деформации липосом, что привело к сильному изгибу липидных структур (рис. 9D). Деформация мембраны и образование пузырьков согласуются с нашими данными SIM и ПЭМ (Рис. 6B – 6E). Очевидно, что сам родомиртон способен изгибать мембрану и образовывать небольшие мембранные пузырьки.

Жидкие липидные скопления и инвагинации мембран у патогенов

Чтобы определить, получены ли результаты с B . subtilis может передаваться патогенным микроорганизмам, мы протестировали образование жидких липидных скоплений, окрашенных DiIC12, и образование мембранных везикул в S . aureus и S . пневмония . Действительно, мы наблюдали четкие мембранные инвагинации у обоих организмов после обработки родомиртоном 1x MIC (1xMIC, 1 мкг / мл) в течение 10 минут с использованием красителя для мембран нильского красного (рис. 10А). Когда S . aureus и S . pneumoniae были окрашены жидким красителем липидных доменов DiIC12, стали видны яркие флуоресцентные пятна, указывающие на накопление жидких липидных доменов (фиг. 10B). SIM-микроскопия тех же клеток с высоким разрешением подтвердила, что эти жидкие, обогащенные липидами домены представляют собой мембранные инвагинации (рис. 10В), показывая, что родомиртон имеет тот же основной механизм действия против клинически значимых патогенов.

Рис. 10. Воздействие родомиртона на S . aureus и S . pneumoniae и эффективность родомиртона против S . pneumoniae инфекция.

С . aureus RN4220 и S . pneumoniae D39 выращивали до ранней логарифмической фазы и обрабатывали 1 мкг / мл родомиртона в течение 10 мин. (A) Фотографии SIM-карты S . aureus и S . pneumoniae окрашено нильским красным. Стрелки указывают на инвагинации мембран в клетках, обработанных родомиртоном. Шкала 2 мкм. (B) DiIC12-окрашенные клетки показывают яркие флуоресцентные пятна после обработки DiIC12 (стрелки, верхние панели). Соответствующие изображения SIM показывают, что эти пятна представляют собой мембранные инвагинации (стрелки, нижние панели). Шкала 2 мкм. (C) Родомиртон снижает бактериальную нагрузку и уменьшает повреждение области сердца у эмбрионов рыб данио, инфицированных S . пневмония . Однодневным эмбрионам рыбок данио вводили 160 КОЕ S . pneumoniae JWV500, экспрессирующие HlpA-GFP в хвостовой вене. Рыб обрабатывали двумя инъекциями (через 45 и 75 минут после заражения) по 25 нг родомиртона каждая. Для обработки в воде непосредственно в воду добавляли 5 мкг / мл родомиртона. Фотографии были сделаны через 18 часов после заражения. Обратите внимание на видимое повреждение области сердца рыбы, вызванное S . pneumoniae (стрелки, левая панель) и яркие флуоресцентные пятна, указывающие на присутствие S . pneumoniae JW500 в этом регионе (стрелки, средняя панель). Уменьшение сигнала флуоресценции по сравнению с необработанными клетками постоянно наблюдалось у всех рыб, которым вводили родомиртон (см. Также S18 фиг.), Но не у рыб, обработанных добавлением соединения в воду. Эксперименты проводили в трех биологических повторностях с 15 рыбами в каждом состоянии в каждой повторности. Шкала 200 мкм.

https://doi.org/10.1371/journal.ppat.1006876.g010

Родомиртон эффективен против

S . pneumoniae инфекция

Хотя завод по производству родомиртона R . tomentosa используется в традиционной азиатской медицине [52], и несколько исследований in vitro показали многообещающие результаты с точки зрения антибактериальной активности и безопасности родомиртона [5-15], пока нет информации о его эффективности в модель заражения животных. Поэтому мы выполнили S . pneumoniae эксперименты по заражению однодневных эмбрионов рыбок данио, хорошо зарекомендовавшая себя модель бактериальной инфекции [53–55].Для наблюдения за эффектом на S . pneumoniae рыб мы использовали штамм, экспрессирующий GFP [53,56]. Используя флуоресцентную микроскопию, мы могли ясно увидеть, что родомиртон значительно снижает бактериальную нагрузку у рыб (рис. 10C, S19, рис.). Заражение эмбрионов рыбок данио S . pneumoniae приводит к характерному повреждению области сердца рыбы и вздутию живота, которые легко можно наблюдать под микроскопом (рис. 10С, рис. S19). Инъекция родомиртона заметно уменьшила этот симптом (Рис. 10C, S19, Рис.).Эти данные показывают, что соединение эффективно против S . pneumoniae инфекция in vivo . Добавление родомиртона в воду не уменьшало бактериальную нагрузку или вздутие живота в области сердца (рис. 10C). Мы не наблюдали признаков токсичности при самой высокой введенной концентрации родомиртона (фиг. 10C, S19, фиг.), Что указывает на наличие терапевтического окна для системного применения.

В частности, мы не наблюдали каких-либо накоплений липидов в жидкости до 200x MIC, когда мы окрашивали эритроциты человека жидким красителем липидного домена DiIC12 (S20, рис.), Что указывает на то, что индукция инвагинаций мембран родомиртоном уникальна для бактериальных мембран.Пока неясно, какой механизм лежит в основе селективности родомиртона в отношении бактериальных клеток. Поэтому мы провели лаурдановую спектроскопию липосом, состоящих либо из POPG, либо из 1-пальмитоил-2-олеоилфосфатидилхолина (POPC). Интересно, что в липосомах POPC не наблюдалось разжижения мембран (S21, фиг.). В отличие от PG, который представляет собой типичный липид бактериальной мембраны, PC в изобилии присутствует в мембранах клеток млекопитающих, но не присутствует в большинстве бактерий. Это может стать первым признаком того, почему родомиртон селективен в отношении бактериальных клеток, а не клеток млекопитающих.

Обсуждение

Механизм действия

Поскольку родомиртон не образует больших пор мембраны и не оказывает сильного воздействия на клеточную стенку, долгое время считалось, что он не нацелен на оболочку бактериальных клеток [5,6,15]. Здесь мы показываем, что родомиртон действует на цитоплазматическую мембрану посредством нового молекулярного механизма, что приводит к образованию крупных мембранных инвагинаций и внутриклеточных пузырьков, которые захватывают мембранные белки. Результаты этого исследования обобщены в рабочей модели, схематически изображенной на рис.11.В отличие от других мембранно-активных антимикробных препаратов [43], родомиртон не имеет четкой амфипатической структуры или домена, взаимодействующих с мембраной, и очень маловероятно, что он будет внедряться в клеточную мембрану. Моделирование молекулярной динамики показало, что множественные повторы связывания и высвобождения вызывают более плотную упаковку головных групп фосфолипидов во внешней створке, что приводит к более широкому распространению жирных кислот во внутренней створке мембраны и изгибу мембраны (фиг. 11A). Кроме того, разжижающие липиды, т.е.е. липиды с короткими, разветвленными или ненасыщенными жирными кислотами с более высокой степенью гибкости будут располагаться в этих местах, поскольку они лучше вписываются в эту неупорядоченную липидную среду, чем менее гибкие липидные молекулы (фиг. 11B). Формирование этих очень жидких доменов в мембране имеет три эффекта. Во-первых, локальное накопление разжижающих липидов приводит к ригидизации остальной клеточной мембраны, что приводит к диссоциации периферических мембранных белков (Рис. 11C), которым требуется определенная степень текучести для вставки их мембрансвязывающих доменов [57].Во-вторых, образование мембранных доменов разной толщины вызывает гидрофобные несовпадения, которые, вероятно, нарушают барьерную функцию мембраны и допускают утечку ионов, ведущую к постепенному рассеиванию мембранного потенциала [19,58–62] (Рис. 11D). И в-третьих, эти очень жидкие липидные домены привлекают как периферические, так и интегральные мембранные белки (Рис. 11E), поскольку более жидкая липидная среда вмещает большинство мембранных белков лучше, чем жесткая среда [57]. Наконец, сочетание локальной кривизны мембраны и высокой концентрации разжижающих липидов стимулирует образование мембранных инвагинаций, ведущих к пузырькам, эффективно улавливая накопленные мембранные белки (рис. 11F).

Рис. 11. Влияние родомиртон-липидного взаимодействия на цитоплазматическую мембрану бактерий (синий) и мембранные белки.

(A) Родомиртон (светло-зеленый) вызывает более плотную упаковку группы головок в створке наружной мембраны, что приводит к положительному искривлению мембраны. (B) Гибкие липиды (красный) притягиваются к участкам положительной кривизны, образуя очень жидкие липидные домены. (C) Привлечение гибких липидов к участкам мембранных инвагинаций приводит к ригидизации остальной мембраны и отслоению периферических мембранных белков. (D) Дефекты межфазной границы между изогнутыми доменами жидкой мембраны и жесткой остальной частью мембраны увеличивают пассивную проницаемость для ионов калия. (E) Как периферические (темно-зеленые), так и интегральные (желтый) мембранные белки привлекаются к инвагинациям мембраны из-за более высокой локальной текучести, приводящей к образованию белковых агрегатов в мембране. (F) Повышенная кривизна достигает кульминации в мембранных инвагинациях, в результате чего в везикулах улавливаются как гибкие липиды, так и мембранные белки.

https://doi.org/10.1371/journal.ppat.1006876.g011

Захват мембранных белков в везикулах родомиртоном нарушает широкий спектр мембранных процессов. Делокализация белков, участвующих в формировании формы клеток (MreB), синтезе клеточной стенки (MurG, MraY, PBP2B) и делении клеток (FtsA, MinD, DivIVA), объясняет влияние B на размер и форму клеток. subtilis , S . aureus и S . pyogenes , которые наблюдались в более ранних исследованиях [17,18,21].В отличие от антимикробных пептидов даптомицина, MP196 и грамицидина S, каждый из которых влияет на функцию белка синтеза клеточной стенки MurG [19,27], родомиртон не оказывал немедленного воздействия на целостность клеточной стенки (рис. 3B), что было удивительно, учитывая тот факт, что соединение делокализует MurG, MraY и PBP2B. Однако это хорошо согласуется со стрессовой реакцией S . aureus на лечение родомиртоном, которое не показало положительной регуляции типичных белков стресса клеточной оболочки, таких как двухкомпонентная система liaRS [17,63].Более того, дефекты формы клеток, вызванные родомиртоном, становятся видимыми только после продолжительного лечения от одного до четырех часов [18], что позволяет предположить, что ингибирование синтеза клеточной стенки не является основным механизмом ингибирования роста.

Хотя родомиртон не оказывал немедленного воздействия на синтез клеточной стенки, он оказывал быстрое и сильное влияние на клеточное дыхание (рис. 3F), вероятно, из-за замещения белков дыхательной цепи, таких как SdhA, и диссоциации комплекса АТФ-синтазы FoF1 (рис. 2A). и 6A и S17 фиг.).Это согласуется с наблюдаемой активацией метаболических путей в более ранних исследованиях родомиртона [21], поскольку истощение энергии (ограничение АТФ) обычно приводит к неспецифическому ингибированию синтеза основных клеточных макромолекул [19,27]. Столь сильное ингибирующее действие на клеточное дыхание еще не наблюдалось у других антибиотиков, вызывающих делокализацию мембранных белков, включая даптомицин, MP196 и грамицидин S [19,27]. Фактически, ни один другой протестированный антибиотик до сих пор не способствовал делокализации АТФ-синтазы [19,24,27].

Родомиртон действует иначе, чем известные противомикробные соединения

Распространено мнение, что антибиотики, нацеленные на мембрану, образуют поры или ионные каналы [64]. Однако за последние несколько лет был обнаружен ряд соединений, нацеленных на мембрану, которые не образуют поры мембран, включая антимикробные пептиды даптомицин, cWFW, MP196 и грамицидин S [19,27,65]. В то время как даптомицин специфически встраивается в специализированные микродомены мембраны [19], другие соединения действуют согласно модели межфазной активности, т.е.е. они не проникают достаточно глубоко в бислой мембраны, чтобы сформировать поры, охватывающие мембрану, а скорее действуют на границе раздела между головными группами фосфолипидов и цепями жирных кислот мембранных липидов, что приводит к деформации мембраны [66]. Ни одна из этих моделей не применима к родомиртону, который связывается только с головными группами фосфолипидов и не интеркалирует между липидами мембран. Таким образом, родомиртон является первым антибиотиком, который достигает существенных изменений в архитектуре мембраны исключительно за счет связывания с головными группами фосфолипидов в листке наружной мембраны.

Даптомицин, MP196 и грамицидин S также влияют на локализацию определенных мембранных белков (MurG и PlsX или MurG и цитохрома c , соответственно) [19,27], а антимикробный пептид cWFW пространственно разделяет периферические и интегральные мембранные белки на домены разная текучесть [67]. Однако родомиртон уникален тем, что он сильно влияет на очень широкий спектр мембранных белков и улавливает эти белки во внутриклеточных мембранных везикулах.

Клинические последствия

Р . tomentosa Отвары листьев традиционно используются в Азии для лечения желудочно-кишечных инфекций и предотвращения послеродовых инфекций, а измельченные листья применяют в качестве повязок на раны [52]. Родомиртон, выделенный из экстрактов этих листьев [8], не только бактерициден и очень эффективен против ряда важных бактериальных патогенов, но также принадлежит к новому классу соединений и обладает новым механизмом действия. Хотя оставалось неясным, какой механизм лежит в основе его селективности в отношении бактериальных мембран, было показано, что соединение не проявляет токсичности в отношении клеток млекопитающих [6,8,11].Здесь мы могли бы дать первый ключ к разгадке механизма, лежащего в основе селективности родомиртона, который, по-видимому, имеет более высокое сродство к липидам мембран бактерий по сравнению с липидами мембран млекопитающих (S20 и S21, рис.). Мы также могли бы впервые показать, что родомиртон эффективен против бактерий на модели инфекции, предлагая терапевтическое окно для системного лечения.

Поскольку родомиртон влияет на ряд различных клеточных процессов, а не на одну белковую мишень, быстрого развития устойчивости к этому соединению не ожидается.Фактически не существует стабильного резистентного к родомиртону S . Мутант aureus может быть выделен в экспериментах по множественному пассированию [6]. Бактерии выработали несколько механизмов устойчивости к антибиотикам, нацеленным на мембрану. Например, снижение содержания PG (в пользу L-PG или кардиолипина) в цитоплазматической мембране и модификации заряда клеточной стенки являются наиболее эффективным механизмом устойчивости против даптомицина и других соединений, нацеленных на мембрану [43,44]. В отличие от таких соединений, у родомиртона нет сильного предпочтения ни для отрицательно заряженных (PG), ни для нейтральных фосфолипидных (PE) головных групп, и на его активность не влияют изменения концентрации одного из основных видов фосфолипидов в бактериях ( Рис 9A).Кроме того, родомиртон делокализует важные мембраносвязанные липид-синтазы (PlsX, PgsA), тем самым затрудняя возможные попытки бактериальной клетки адаптировать липидный состав мембраны. Более того, родомиртон не заряжен и, следовательно, на него также вряд ли повлияет D-аланилирование липотейхоевых кислот в клеточной стенке, общий механизм адаптации к положительно заряженным антимикробным молекулам [68]. Следовательно, общие механизмы устойчивости к другим соединениям, направленным на мембрану, вероятно, не эффективны против родомиртона, сводя к минимуму риск перекрестной резистентности с другими антибиотиками.Фактически, родомиртон активен против устойчивых к ванкомицину штаммов S . aureus [6]. Кроме того, он эффективен против нерастущих антибиотикоустойчивых бактериальных культур (S22, рис.), Что позволяет предположить, что он также может уничтожать клетки-персистеры, которые вызывают спящие и повторяющиеся инфекции. В заключение, родомиртон — новый мощный кандидат в антибиотики, который принадлежит к новому классу соединений и обладает уникальным механизмом действия.

Материалы и методы

Антибиотики

Родомиртон экстрагировали из листьев Rhodomyrtus tomentosa с помощью 95% этанола, как описано ранее [21,69].MP196 был синтезирован, как описано ранее [70]. Даптомицин был приобретен у Novartis. Все остальные антибиотики были приобретены у Sigma Aldrich с максимально возможной степенью чистоты. Родомиртон, грамицидин, грамицидин S, триклозан, CCCP, MP196, бензиловый спирт и митомицин C растворяли в стерильном ДМСО. Даптомицин, ципрофлоксацин и азид натрия растворяли в стерильной воде. Хлорамфеникол, эритромицин и рифампицин растворяли в этаноле. Бактерицидную концентрацию ципрофлоксацина определяли путем посева культур, обработанных антибиотиком, в течение 10 мин на чашки с неселективным агаром.Обработка ципрофлоксацином 1 мкг / мл не привела к отсутствию КОЕ после инкубации в течение ночи.

Штаммы бактерий и условия роста

Б . Штаммы subtilis , использованные в этом исследовании, перечислены в таблице S1. Если не указано иное, все штаммы выращивали в бульоне Luria Bertani (LB) при 37 ° C или 30 ° C (для микроскопии) при постоянном перемешивании в присутствии индуктора, где это необходимо (см. Таблицу S1). Штамм 4277 выращивали в присутствии 20 мМ MgCl 2 .Штамм HM1365 выращивали в присутствии маркера селекции. С . aureus выращивали в LB при 37 ° C. С . pneumoniae выращивали в бульоне Тодда-Хьюитта с добавлением 0,5% дрожжевого экстракта при 37 ° C. Все эксперименты проводились в ранней фазе экспоненциального роста (OD 600 = 0,3–0,35). Если не указано иное, эксперименты проводили в трех биологических повторностях.

Конструкция штамма

Штамм

UG-10 ( amyE :: spc Pxyl-recA-mgfp ) был сконструирован путем рестрикционного клонирования гена recA в плазмиду pSG1729 [71] с использованием Escherichia coli Top 10 в качестве хозяина для клонирования.RecA амплифицировали с праймерами UG03a (5’GCGCGCCTCGAGATGAGTGATCGTCAGGCAGCC3 ’) и UG04a (5’CGCGCGGAATTCGGATCCTGAGCCGCTTCCTGAGCCTTCTTCAAATTCGAGTTC3’ и EcoRI-сайты клонировали в сайты рестрикции. Полученную плазмиду (TNVS- recA -4GS- mgfp ) трансформировали в B . subtilis 168 с использованием стандартного протокола голодания [72]. TNVS30D ( amyE :: spc-Pxyl-mgfp-pgsA ) был сконструирован путем рестрикционного клонирования в плазмиду pSG1729 (несущую мономерный GFP) с использованием сайтов рестрикции XhoI / EagI.Ген pgsA амплифицировали с использованием праймеров pgsA-Fw (gggCTCGAGggctcaggaagcggctcaggatccTTTAACTTACCAATAAAATCACACTAGCT) и pgsA-Re (cccCGGCCGttaGTTAGATGTTTTAACGCTTCCCC). Полученную плазмиду (pTNV13) трансформировали в B . subtilis 168, в результате чего образуется штамм TNVS30D.

Минимальная ингибирующая концентрация (МИК) и кривая роста

МИК

определяли с помощью модифицированного метода микроразбавления бульона, рекомендованного в рекомендациях Института стандартизации клинической лаборатории (CLSI).Были приготовлены двукратные серийные разведения родомиртона в LB в формате 96-луночного микротитровального планшета. Экспоненциально растет B . subtilis 168 инокулировали в каждую лунку до конечного количества колониеобразующих единиц (КОЕ) 5 × 10 5 КОЕ / мл и инкубировали при 37 ° C в течение 16 часов. МИК определяли как самую низкую концентрацию, ингибирующую видимый рост.

Эксперименты по выращиванию проводили с использованием планшет-ридера Biotek Synergy MX в 96-луночном формате при непрерывном встряхивании в конечном объеме 150 мкл на лунку. В . subtilis 168 выращивали в LB при 37 ° C до OD 600 0,3 и затем обрабатывали 0,25, 0,5 и 1 мкг / мл родомиртона (0,5x, 1x и 2x МИК) или оставляли без обработки в качестве контроля. .

Локализация флуоресцентных слияний белков

Штаммы, экспрессирующие слитые флуоресцентные белки, выращивали при 30 ° C в присутствии соответствующих концентраций индукторов (таблица S1) до OD 600 , равного 0,3. Впоследствии клетки обрабатывали 0.5 мкг / мл (1x МИК) родомиртона или 1% ДМСО (отрицательный контроль). Если не указано иное, образцы для микроскопии отбирали через 10 и 30 мин. Клетки иммобилизовали на тонкой пленке из 1% агарозы и сразу же наблюдали с помощью микроскопа Olympus BX 50, оснащенного цифровой камерой Photometrics CoolSNAP fx. Изображения были проанализированы с помощью Image J.

.

Покадровая микроскопия

Б . subtilis HS63 ( divIVA msfgfp ) выращивали, как описано выше.Клетки помещали на пластыри из 1% агарозы, содержащие 10% LB, и помещали в предварительно нагретую проточную камеру (Ibidi sticky-Slide VI 0.4). Клетки хранили при 30 ° C в постоянном потоке среды (10% LB, 20 мкл / мин) и позволяли регулироваться в течение 10 мин. После получения изображения необработанных клеток родомиртон, разведенный в 10% LB до конечной концентрации 0,5 мкг / мл (1x MIC), подавали в камеру с непрерывным потоком 20 мкл / мин. Изображения получали каждые 2 мин в течение 30 мин. Изображения были получены с помощью микроскопа Nikon Eclipse Ti, оснащенного масляным объективом CFI Plan Apochromat DM 100x, лампой Intensilight HG 130 Вт, камерой C11440-22CU Hamamatsu ORCA и программным обеспечением NIS elements, версия 4.20.01. Изображения были проанализированы с помощью Image J.

.

Анализ целостности клеточной стенки

Экспоненциально растущий (37 ° C) B . subtilis 168 клетки обрабатывали 0,5 мкг / мл (1x МИК) или 1 мкг / мл (2x МИК) родомиртона, 1 мкг / мл грамицидина S, 1 мкг / мл даптомицина (в присутствии 1,25 мМ CaCl 2 ) или 10 мкг / мл MP196 в течение 10 мин. Отбирали 200 мкл образца и смешивали с 1 мл метанола уксусной кислоты 1: 3. Эта органическая фиксация приводит к экструзии протопласта через отверстия в клеточной стенке, что происходит, когда синтез липида II ингибируется, в то время как автолизины клеточной стенки все еще активны [26].Клетки помещали на пленки 1% агарозы и наблюдали с помощью фазово-контрастной микроскопии с использованием микроскопа Nikon Eclipse Ti, как указано выше.

Измерение мембранного потенциала

Мембранный потенциал определяли с помощью потенциометрического флуоресцентного зонда 3,3′-дипропилтиадикарбоцианина йодида (DiSC 3 (5)) с использованием планшет-ридера Biotek Synergy MX, как описано ранее [28]. Короче говоря, 1 мкМ DiSC 3 (5) добавляли к экспоненциально растущему (37 ° C) B . subtilis 168 культур и базовый уровень регистрировали в течение 5 мин (возбуждение 651 нм, испускание 675 нм). Добавляли соединения (0,5 мкг / мл (1x МИК), 1 мкг / мл (2x МИК) родомиртона, 1 мкг / мл грамицидина (1x МИК), 1% ДМСО), и образцы измеряли еще в течение 25 мин (37 ° C, трясется).

Пористое пятно на йодиде пропидия (PI)

Экспоненциально растущий (37 ° C) B . subtilis 168 культур обрабатывали 0,5 мкг / мл (1x MIC), 1 мкг / мл (2x MIC), 2 мкг / мл (4x MIC) родомиртоном, 0.5% SDS (положительный контроль) или 1% DMSO (отрицательный контроль). Образцы отбирали через 5, 10, 15 или 30 минут и окрашивали 10 мкг / мл PI в течение 5 минут в темноте (37 ° C, встряхивание). Клетки дважды промывали предварительно нагретым фосфатно-солевым буфером (PBS) и ресуспендировали в том же буфере. Флуоресценцию PI измеряли с использованием планшет-ридера Biotek Synergy MX (возбуждение 535 нм, испускание 617 нм).

Утечка калия

Б . subtilis 168 выращивали на минимальной среде Белицкого (BMM) при 37 ° C при постоянном перемешивании до ранней логарифмической фазы.Клетки окрашивали 5 мкМ Asante Potassium Green-2 (APG-2) в течение 60 мин в темноте (37 ° C, встряхивание). Образцы дважды промывали предварительно нагретым BMM и ресуспендировали в той же среде. Клетки переносили в 96-луночные планшеты из черного полистирола и регистрировали исходный уровень в течение 10 мин (37 ° C, встряхивание) с использованием планшет-ридера Biotek Synergy MX (возбуждение 488 нм, эмиссия 540 нм). Затем были добавлены антибиотики (0,5 мкг / мл (1x MIC), 1 мкг / мл (2x MIC) и 2 мкг / мл (4x MIC) родомиртона, 1 мкг / мл (1x MIC) и 2 мкг / мл (2x MIC). MIC) грамицидин (положительный контроль), 1% ДМСО (отрицательный контроль)) и флуоресценцию измеряли в течение дополнительных 20 минут (37 ° C, встряхивание).

Резазурин проба

Редукционная способность B . subtilis 168 клеток, показывающих активность дыхательной цепи, измеряли с резазурином, как описано ранее [19]. Экспоненциально растущие клетки (37 ° C) обрабатывали 0,25 мкг / мл (0,5 х МИК), 0,5 мкг / мл (1 х МИК) и 1 мкг / мл (2 х МИК) родомиртона, 100 мкМ CCCP или 150 мкМ натрия. азид. Аликвоты отбирали через 10 и 30 мин и доводили до OD 600 0,15 с помощью предварительно нагретого LB и добавляли 100 мкг / мл резазурина.После 5 мин инкубации (37 ° C, встряхивание) оптическую плотность измеряли при 540 и 630 нм с использованием планшет-ридера Biotek Synergy MX.

Окрашивание мембран

Все мембрано-специфические эксперименты проводились при 30 ° C. Если иное не указано в подписях к фигурам, экспоненциально растущие клетки обрабатывали 0,5 мкг / мл родомиртона (1x MIC) в течение 10 мин. Мембраны окрашивали 2 мкг / мл FM5-95 (Molecular Probes) в течение 10 минут непосредственно перед микроскопией. Нуклеоиды окрашивали 1 мкг / мл DAPI (Thermo Scientific) в течение 2 минут непосредственно перед микроскопией.Для окрашивания RIF с помощью DiIC12 (Anaspec) ночные культуры разбавляли 1: 200 в LB, содержащем 1% ДМСО, 2 мкг / мл DiIC12. Клетки промывали четыре раза и ресуспендировали в предварительно нагретом LB, содержащем 1% ДМСО, перед обработкой антибиотиком. Микроскопию Лаурдана (Sigma Aldrich) проводили, как описано ранее [19]. Анализ изображений, полученных с помощью микроскопии лаурдана, был выполнен с помощью Image J с использованием плагина «calculate GP». Расчет GP из изображений микроскопии требует следующих шагов: корректировка размера изображения, увеличение яркости и контрастности, вычитание фона и расчет GP.Поскольку настройки яркости и контрастности должны быть одинаковыми для обоих изображений, клетки обычно окружены определенным флюоресцентным фоном. Точно так же внутриклеточная фоновая флуоресценция приводит к значениям GP в цитозоле клеток, которые не являются репрезентативными для текучести мембран. Чтобы четко идентифицировать мембрану на этих изображениях, черные и серые изображения GP были наложены на изображение флуоресценции 460 нм (красное). Вся микроскопия проводилась с использованием Nikon Eclipse Ti, как указано выше.

Приготовление липосом

Липосомы были приготовлены из полярного липидного экстракта Escherichia coli , POPG или POPC (Avanti Polar Lipids) с использованием метода детергентного диализа, описанного ранее [24], и экструдированы 20 раз через 0,4 мкм (спектроскопия) или 0,8 мкм (микроскопия). фильтры. Концентрированные (10 мг / мл) исходные растворы липосом разбавляли до 1 мг / мл рабочих растворов в 5 мМ Трис, pH 7,4 (спектроскопия) или 50 мМ Трис, pH 7,4 (микроскопия). Липосомы окрашивали 10 мкМ лаурданом в течение 30 мин или 1 мкг / мл DiIC12 в течение 2 мин.Образцы липосом хранили при 30 ° C на протяжении всех экспериментов. Отношение соединения к липиду in vivo рассчитывали на основе данных липида на клетку, опубликованных для E . coli (2,2×10 7 липидов на клетку) [73], используя наши стандартные условия лечения (OD 600 0,3, 0,5 мкг / мл родомиртона) с учетом того, что B . Клетка subtilis вдвое длиннее клетки E . coli и предполагая, что весь родомиртон будет связан с мембраной.Этот расчет привел к соотношению in vivo соединения к липидам, равному 1:20. Однако, поскольку неизвестно, сколько родомиртона связано с мембраной, свободного в среде или секвестрированного в B . subtilis , это число можно рассматривать только как грубую оценку величины отношения in vivo к липиду .

Спектроскопия Лаурдана

Текучесть мембран определяли в периодическом культивировании с лаурданом, как описано ранее [19].Клетки выращивали до середины логарифмической фазы, окрашивали 10 мкМ лаурданом, промывали четыре раза в PBS с добавлением 2% глюкозы и 1% ДМФ и ресуспендировали в том же буфере с получением OD 600 0,3. Липосомы окрашивали 10 мкМ лаурданом в течение 30 мин. Флуоресценцию лаурдана измеряли в планшет-ридере BioTek Synergy MX, используя возбуждение 350 нм и длину волны излучения 460 и 500 нм. Показания снимали каждые 2 мин. Значения обобщенной поляризации Лаурдана (GP) рассчитывались по следующей формуле: (I 460 -I 500 ) / (I 460 + I 500 ).Антибиотики добавляли к клеткам или липосомам через 4 мин измерений, а флуоресценцию дополнительно измеряли в течение 30 мин.

Анализ липидов

Ночные культуры разводили 1: 100 и выращивали при 30 ° C при постоянном перемешивании. При OD 600 0,3 культуры разделяли и 500 мл обрабатывали 0,25 мкг / мл (0,5 × МИК) родомиртона или 1% ДМСО в качестве отрицательного контроля. Для этих экспериментов были необходимы более низкие концентрации родомиртона из-за разной скорости роста B . subtilis в больших колбах для культивирования клеток по сравнению с микротитровальными планшетами из-за разной аэрации (S23, фиг.). Клетки далее выращивали до OD 600 0,6 и затем охлаждали на шламовом льду в течение 10 минут. Клетки собирали центрифугированием и один раз промывали ледяным 100 мМ NaCl. Осадки промытых клеток немедленно замораживали в жидком азоте и лиофилизировали при -50 ° C в течение ночи. Осушенные вымораживанием гранулы обрабатывали ультразвуком и растворяли в гексане перед анализом методом газовой хроматографии-масс-спектрометрии (ГХ-МС), как описано Medema et al .[74]. Вкратце, образцы помещали в 1 мл реагента для трансметилирования (3 M HCl в метаноле) и инкубировали в присутствии 10 нмоль внутреннего стандарта (метиловый эфир 18-метилнонадекановой кислоты) при 90 ° C в течение 4 часов. После охлаждения водный слой экстрагировали 2 мл гексана, сушили в токе азота и ресуспендировали в 80 мкл гексана. Один микролитр этого раствора вводили в газовый хроматограф (Hewlett Packard GC 5890), оборудованный колонкой для ГХ Agilent J&W HP-FFAP, 25 м, 0,20 мм, 0,33 мкм.Элюирующие метиловые эфиры жирных кислот детектировали пламенной ионизацией. Концентрации жирных кислот рассчитывали с использованием известного количества внутреннего стандарта и выражали в процентах от общего количества липидов. Эксперименты проводились в биологических дубликатах.

Микроскопия со структурированным освещением (SIM)

3D SIM была выполнена с использованием микроскопа Nikon Eclipse Ti N-SIM E, оснащенного масляным объективом CFI SR Apochromat TIRF 100x (NA1.49), лазерным блоком LU-N3-SIM, Orca-Flash 4.0 sCMOS (Hamamatsu Photonics K.K.) и программное обеспечение NIS elements Ar. Культуры выращивали и помещали на предметные стекла для микроскопии, как описано выше. Клеточные мембраны окрашивали 1 мкг / мл митотрекерного зеленого или 1 мкг / мл нильского красного в течение 2 мин. Липосомы окрашивали 1 мкг / мл DiIC12. Для наблюдения образцов, окрашенных нильским красным или DiIC12, покровные стекла покрывали полидофамином, как описано ранее [28].

Просвечивающая электронная микроскопия

Б . subtilis 168 выращивали в аэробных условиях в LB до OD 600 , равного 0.3 и затем обрабатывали 0,5 мкг / мл (1x МИК) родомиртоном или оставляли без обработки в качестве контроля. После 10 мин обработки антибиотиком 200 мкл образца отбирали, осаждали центрифугированием (16000 x g, 1 мин) и ресуспендировали в 10 мкл свежего LB. Концентрированные клеточные суспензии наносили пятнами на 1,5% агарозные пятна толщиной 0,25 мм (Gene Frame AB0576, ThermoFischer Scientific) и давали им высохнуть. Пятна агарозы переносили в алюминиевые чашки и клетки фиксировали 5% глутаральдегидом в 0,1 М какодилатном буфере (pH 7.4) на 20 мин. После фиксации образцы трижды промывали 0,1 М какодилатом, pH 7,4, в течение 5 минут каждый с последующей инкубацией в 1% OsO 4 (EMS) / 1% KRu (III) (CN) 6 (Sigma Aldrich) на 30 мин и трехкратное промывание ультрачистой водой по 5 мин каждое. Дегидратацию проводили в серии этапов инкубации с возрастающими концентрациями сверхчистого этанола следующим образом: 5 мин 30% этанол, 5 мин 50% этанол, дважды 15 мин 70% этанол, 1 час 80% этанол, 15 мин 90% этанол, 15 мин. 96% этанол, 15 мин. 100% этанол, 30 мин. 100% этанол, без воды.Затем клетки инкубировали в течение 30 минут в смеси EPON и пропиленоксида 1: 1 с последующим 30-минутным инкубированием в 2: 1 EPON / пропиленоксиде. Затем пятна агарозы переносили в свежие алюминиевые чашки, накрывали свежим EPON и инкубировали при 65 ° C в течение 48 часов. После заделки была выбрана интересующая область путем наблюдения за внедренным EPON бактериальным слоем под световым микроскопом и смонтирована для получения тонких срезов. Ультратонкие срезы (~ 80 нм) вырезали параллельно бактериальному слою, собирали на однослотовых медных сетках, покрытых формваром, и затем контрастировали уранилацетатом (Ultrostain I, лаурилаб) и цитратом свинца (Reynolds) в Leica EM AC20. ультрастейнер.Бактерии получали изображение при 6000-кратном увеличении с использованием просвечивающего электронного микроскопа JEOL 1010 при электронном напряжении 60 кВ с использованием боковой камеры CCD (Modera, EMSIS).

Моделирование молекулярной динамики

Для имитации B . subtilis , использовали фосфолипидный бислой, состоящий из 1-пальмитоил-2-олеоил-фосфатидилглицерина (POPG) и 1-пальмитоил-2-олеоилфосфатидилэтаноламина (POPE) в соотношении 3: 1 [75,76]. Были созданы две мембранные системы: одна с (S) — и одна с (R) -родомиртоном.Двухслойная система содержала всего 60 липидов в каждой створке и было построено около 4000 молекул воды. Ионы натрия добавляли для нейтрализации отрицательно заряженных головных групп каждой молекулы POPG. Случайным образом добавляли (R) — или (S) -родомиртон. Приготовление всех систем одновременно выполняли с помощью программы Packmol [77]. Размерный размер был в прямоугольной коробке 60 Å × 60 Å × 120 Å. Все моделирование было выполнено в 1000 шагов с использованием алгоритма наискорейшего спуска с последующими 1000 шагами минимизации сопряженного градиента.Для уравновешивания системы было выполнено моделирование 0,5 нс NVT и 5,5 нс NPT при 310 К и 1 атм. Затем производственное моделирование (NPT) для каждой липидной системы было проведено в ансамбле NPT при 310 К и 1 атм в течение 220 нс. Во всех симуляциях использовались периодические граничные условия, сетка частиц Ewald с отсечкой 10 A ° и алгоритм SHAKE для ограничения связей, содержащих атомы водорода. Все моделирование МД проводилось с помощью PMEMD, реализованной в пакете AMBER16. Первые 120 нс моделирования были опущены, а последние 1000 эквидистантных снимков 100 нс моделирования были взяты для усреднения и анализа.Анализ проводился с использованием модуля CPPTRAJ в пакете AMBER16 и пользовательских программ, написанных на языке Fortran 95. Визуализация осуществлялась с помощью пакета Visual Molecular Dynamics (VMD 1.9.3) [78]. Вероятность взаимодействия липида липидного типа с родомиртоном рассчитывалась следующим образом:

Эксперименты с эмбрионами рыбок данио

Все методы были выполнены в соответствии с соответствующими инструкциями и правилами. Danio rerio (рыба данио) обрабатывались в соответствии с местными правилами защиты животных и содержались в соответствии со стандартными протоколами (zfin.org). Разведение рыбок данио в уполномоченных учреждениях, таких как Амстердамский центр исследований животных при Университете Амстердама, полностью соответствует голландскому закону об исследованиях на животных. Все эксперименты на животных контролируются местной организацией по защите животных (Instantie voor Dierenwelzijn, IvD) Университета VU и Медицинским центром Университета VU (IvD VU / VUmc). Все используемые протоколы исследований соответствуют международным рекомендациям по защите животных, используемых в научных целях, Директиве ЕС по защите животных 2010/63 / EU, которая позволяет использовать эмбрионы рыбок данио до того момента, когда они смогут самостоятельно принимать внешние корм (через 5 дней после оплодотворения) без дополнительного одобрения Центрального комитета экспериментов на животных в Нидерландах (Centrale Commissie Dierproeven, CCD).Поскольку эмбрионы рыбок данио, использованные в этом исследовании, соответствуют этим критериям, это конкретное исследование было одобрено IvD VU / VUmc. Эмбрионы рыбок данио Casper были инфицированы через 1 день после оплодотворения в хвостовой вене с помощью микроинъекции зеленым флуоресцентным штаммом Streptococcus pneumoniae D39, в котором зеленый флуоресцентный белок суперпапки слит с HlpA, как описано ранее [56,79]. Эмбрионы обрабатывали через 45 мин после заражения либо микроинъекцией родомиртона в хвостовую вену, либо добавлением соединения в воду в указанных концентрациях.Инфицированные эмбрионы контролировались в определенные моменты времени с помощью флуоресцентного микроскопа Leica MZ16FA, присоединенного к камере Leica DFC420C. Все эксперименты проводили в трех повторностях.

Активность в отношении нерастущих клеток

Б . subtilis 168 выращивали в течение ночи при 37 ° C. Затем культуры стационарной фазы инкубировали с 4 или 40 мкг / мл родомиртона или грамицидина S соответственно в течение 9 ч при 37 ° C при непрерывном встряхивании. Количество КОЕ определяли путем посева серии разведений на чашки LB без антибиотиков.

Вспомогательная информация

S2 Таблица. Адаптация жирнокислотного состава мембранных липидов.

В . subtilis 168 выращивали до OD 600 0,3 и обрабатывали 0,25 мкг / мл родомиртона (0,5x МИК, субингибиторный). Клетки собирали после достижения OD 600 0,6. dev: стандартное отклонение среднего.

https://doi.org/10.1371/journal.ppat.1006876.s002

(DOCX)

S3 Таблица.Необработанные данные и анализ жирных кислот.

В . subtilis 168 выращивали до OD 600 0,3 и обрабатывали 0,25 мкг / мл родомиртона (0,5x МИК). Клетки собирали после достижения OD 600 0,6. dev: стандартное отклонение.

https://doi.org/10.1371/journal.ppat.1006876.s003

(DOCX)

S5 Таблица. Минимальные ингибирующие концентрации различных антибиотиков против штамма истощения PG HM1365 по сравнению с

B . subtilis WT.

Истощение незаменимых липидов PG приводит к дефектам роста и морфологическим изменениям 15 , что приводит к гиперчувствительности к антибиотикам ( жирным шрифтом ) в B . subtilis . Даптомицин является исключением из этого правила, поскольку его активность зависит от присутствия PG, что приводит к более высокой толерантности к даптомицину штамма, истощающего PG.

https://doi.org/10.1371/journal.ppat.1006876.s005

(DOCX)

S1 Фиг.Делокализация внутриклеточных белков специфическими ингибиторами.

Клетки обрабатывали антибиотиками в течение 10 минут (0,1 мкг / мл ципрофлоксацина, 0,1 мкг / мл рифампицина, 0,2 мкг / мл эритромицина) или 60 минут (0,05 мкг / мл митомицина C) в средней логарифмической фазе. Шкала 2 мкм.

https://doi.org/10.1371/journal.ppat.1006876.s006

(TIF)

S8 Рис. Обзор клеток, окрашенных DAPI, обработанных родомиртоном.

Клетки обрабатывали 1x MIC в течение 10 мин. Обратите внимание на неоднородность окрашивания DAPI из-за повышенной проницаемости мембраны в сильно пораженных клетках.Шкала 5 мкм.

https://doi.org/10.1371/journal.ppat.1006876.s013

(TIF)

S9 Рис. Зависимое от фазы роста образование видимых RIF, окрашенных DilC12.

В . subtilis 168 выращивали в аэробных условиях в LB при 30 ° C. Дискретные РИФ становятся видимыми при логарифмическом росте и исчезают при переходе в стационарную фазу.

https://doi.org/10.1371/journal.ppat.1006876.s014

(TIF)

S13 Рис. Остановка роста не вызывает разжижение мембраны.

В . subtilis 168 обрабатывали ципрофлоксацином в бактерицидной концентрации (1 мкг / мл) в течение 10 мин перед спектроскопическими (A) или микроскопическими (B) измерениями текучести с лаурданом.

https://doi.org/10.1371/journal.ppat.1006876.s018

(TIF)

S15 Рис. Ингибирование синтеза белка или синтеза липидов не блокирует образование участков на мембране.

Клетки предварительно обрабатывали 100 мкг / мл хлорамфеникола (левые панели) или 2.5 мкг / мл триклозана (правые панели) в течение 10 мин для подавления синтеза белков и липидов соответственно. Впоследствии был добавлен родомиртон, и еще через 10 мин были сделаны снимки. Мембраны окрашивали FM5-95.

https://doi.org/10.1371/journal.ppat.1006876.s020

(TIF)

S16 Рис. Мембранные белки не перемещаются к своей нормальной локализации в течение 1 часа после добавления соединения.

В . subtilis TNVS284 ( mraY-gfp ) обрабатывали 1x MIC родомиртона в течение 60 мин.Мембраны окрашивали FM5-95. Красные квадраты указывают на то, что MraY попал в мембранные инвагинации, вызванные родомиртоном. Шкала 2 мкм.

https://doi.org/10.1371/journal.ppat.1006876.s021

(TIF)

S17 Рис. Моделирование молекулярной динамики с несколькими молекулами родомиртона.

Моделирование проводилось с одной (A) , двумя (B) , четырьмя (C) или восемью (D) молекулами родомиртона. На снимках показаны агрегированные молекулы родомиртона, взаимодействующие с головными группами фосфолипидов.Стрелки указывают на нарушение бислоя с точки зрения разрастания жирной ацильной цепи.

https://doi.org/10.1371/journal.ppat.1006876.s022

(TIF)

S18 Рис. Низкие концентрации родомиртона могут вымываться из клеток.

В . subtilis 168 обрабатывали родомиртоном в течение 2 или 10 минут соответственно, а затем дважды промывали предварительно нагретой средой LB. Затем клеткам давали возможность расти в течение 1 часа и исследовали под микроскопом. Мембраны окрашивали FM5-95.Стрелки указывают на участки на мембране, вызванные родомиртоном. Шкала 2 мкм.

https://doi.org/10.1371/journal.ppat.1006876.s023

(TIF)

S19 Рис. Воздействие родомиртона на эмбрионы рыбок данио, инфицированные

S . пневмония .

(A) Рыбы, обработанные родомиртоном, постоянно демонстрировали меньшую зеленую флуоресценцию, вызванную инфицированием GFP-экспрессирующим штаммом S . пневмония . (B) Родомиртон предотвращает повреждение области сердца, вызванное S .Инфекция pneumoniae (красные стрелки). Повреждение области сердца наблюдалось у 80% необработанных и 30% рыб, получавших родомиртон. Однодневным эмбрионам рыбок данио вводили 160 КОЕ S . pneumoniae JWV500, экспрессирующие HlpA-GFP в хвостовой вене. Рыб обрабатывали двумя инъекциями (через 45 и 75 минут после заражения) по 25 нг родомиртона каждая. Фотографии были сделаны через 18 часов после заражения. Эксперименты проводили в трех биологических повторностях с минимум 15 рыбами в каждом состоянии в каждой повторности.

https://doi.org/10.1371/journal.ppat.1006876.s024

(TIF)

S20 Рис. Влияние родомиртона на эритроциты человека.

Свежую кровь здорового донора окрашивали 16 мкг / мл DiIC12 в течение 10 минут и затем обрабатывали родомиртоном в течение дополнительных 10 минут перед исследованием с помощью флуоресцентной световой микроскопии. Шкала 10 мкм.

https://doi.org/10.1371/journal.ppat.1006876.s025

(TIF)

S21 Рис. Разжижающее действие родомиртона на липосомы POPG и POPC.

PG является одним из основных видов мембранных липидов бактерий, но лишь изредка присутствует в клетках млекопитающих, тогда как PC является основным компонентом мембран млекопитающих, но отсутствует в большинстве бактериальных мембран. Зеленый: необработанный. Синий: 50 мкг / мл родомиртона (соотношение соединения и липидов 1: 7).

https://doi.org/10.1371/journal.ppat.1006876.s026

(TIF)

S22 Фиг. Активность родомиртона против нерастущих (ночных) культур

B . subtilis 168.

Клетки с неподвижной фазой обрабатывали соединениями в течение 9 ч перед посевом на чашки с неселективным агаром LB. Грамицидин S, который, как известно, убивает клетки-персистеры 16 , использовали в качестве контроля.

https://doi.org/10.1371/journal.ppat.1006876.s027

(TIF)

S23 Рис. Рост культур, используемых для анализа жирных кислот.

В отличие от экспериментов по выращиванию в 96-луночных микротитровальных планшетах (фиг. 3A), 1x MIC приводил к полному подавлению роста в этом эксперименте (500 мл встряхиваемых культур в 3-литровых колбах) из-за разной подачи кислорода и последующих различий в скорости роста.Поэтому для анализа жирных кислот использовали 0,5-кратный МИК.

https://doi.org/10.1371/journal.ppat.1006876.s028

(TIF)

ВАЗ-21126, мотор. Skaaimerken en Характеристики

VAZ-21126 inline motor hat ferspraat ynjeksje, fjouwer-beroerte en camshafts lizze yn it boppeste part. Lykas de Measte moderne ynterne ferbaarningsmotor motor, de Cooling Floeistof, sletten, oplage wurdt twongen. Смазочный двигатель ûnderdielen produsearre troch spuiten ûnder druk.Мотоциклы установлены на современных моделях вентиляторов ВАЗ — «Приор» и на новых автомобилях.

Новый двигатель вентилятора

Произвести установленный двигатель ВАЗ-21126 на всех моделях Lada Priora, установленный на модификацию. Guon automotivebilisten sûnder ienich alterations sette sokke motors mei «tsientallen» en de tolfde. В настройке вентилятора soarte, dat makket it mooglik om te brûke mear skaaimerken — ynstelling Góra, лучший кондиционер, это mooglik sûnder alterations. Tagelyk der ûntwikkeling 11194 search motor, dus de Measte ûnderdielen is itselde, nettsjinsteande it feit dat de wurkjende folume ferskilt wêzentlik.De taak fan de ûntwikkelders yn it ntwerp wie om gâns tanimme it libben fan ‘e motor. En om te kommen ta in doel is it fergrutsjen fan de tsjinst it libben as all yndividuele komponinten.

На автомобиле «Приора» с двигателем 21126 не обошлось без вентилятора с двигателем ВАЗ-21124. Mar se ha in protte ferskillen: minder gewicht en ôfmjittings fan alle eleminten. Bygelyks, de Pistons binne yn deselde romte op в модели 21126 gewicht per hûndert gram minder. De hichte fan it ynterne ferbaarningsmotor моторный блок 197.1 мм — fstân tusken de as fan rotaasje fan de motor crankshaft oan de top fleanmasine. Strukturele ferskillen út dat brûkt op ‘e motor unit 21124 11193-1002011 net. Haadfunksjes — это в экстрим-хеге kwaliteit ferwurking fan silinders, like goed as feroaringen yn ‘e rjochting fan’ e gruttere hichte.

Главный мотор вентилятора skaaimerken

Двигатель ВАЗ-21126 в колпаке wurkgroep folume вентилятор 1,6 л (krekter sein, de 1,597). Нормальный компрессорный агрегат двигателя 11, это силовой агрегат 4.Общая мощность вращающегося вентилятора Snelheid 5600 об / мин — 98 л. 72 кВт. Скорость холостого хода коленчатого вала 800-850 об / мин. Нет вращения вентилятора коленчатого вала 4000 об / мин ûntwikkelt max koppel fan 145 Нм. Sokke data hat de motor 21126. Priis Brûkt meganisme — это 25000 roebels boppe. Nije kosten folle mear.

Skaaimerken fan de silinder-zuiger groep:

  1. Zuiger beroerte 75,6 мм.
  2. Диаметр двигателя вентилятора 82 мм.
  3. Фентилен — 16.
  4. Silinders wurkje neffens it skema 1-3-4-2.

Ynjeksje ferspraat, behear troch de wei fan digitale elektroanyske ienheid. Двигатель установлен 95-м бензином, вентилятором и вентилятором Mingsel Plakfynt Spark ûntstekking типа AU17DVRM от BCPR6ES (NGK). Двигатель gewicht yn de samle steat — sa’n 115 кг.

motor zuiger groep

Untwikkeling fan zuiger groep — он находится в fertsjinste fan it bedriuw Federal Mogul. Saakkundigen makken de motor mei de eleminten waans gewicht — это лучше, чем двигатели вентилятора типа ВАЗ-21124.Мар как wy ferlykje mei it VAZ-2110, dan wurdt sjoen dat de massa fan de поршневой ôfnommen troch likernôch in tredde. Диаметр поршневого вентилятора bliuwt net feroare, mar de hichte ôfnommen gâns. Ek brûkt tinner поршневое кольцо en ​​lytsere пальцы. Dit daliks effect op de snelheid en macht skaaimerken fan ‘e motor. De makliker это ом, размотайте sels, wat mear macht kin jaan oan it fak.

Oan de ûnderkant fan de поршневая шляпа в lyts djipte fan ‘e boarnen. Он обеспечивает крепление пальца со смещением относительно оси на миллиметр заживления.Диаметр вентилятора для установки его на штифт — 18 мм. Крепление wurdt dien troch middel fan behâld fan ringen, ynstallaasje yn de zuiger stôk — mei в минимальном количестве. Dit soarget foar de ltste ferpleatsing lâns de roede as fan de crankshaft tydskriften.

Crank Meganisme

Needsaaklikerwize útfierd HONING — Tapassen fyn patroan yn in roaster op ‘e ynderlike oerflak Fan de Silinder Liner. De kwaliteit fan de beropsbefolking oerflak krijt hege sûnt ferwurking wurdt útfierd troch Federal Mogul Technology.Маркировка блока цилиндров ВАЗ-21126 фентилен 16 мэй индекс 1.002.011, это тапаст оан де метаал эрфлак. Покрытие вентилятора сокке модификация ienheid — griis.

Silinders 21126 hawwe trije klassen, maten ferskille troch 0,01 мм (краткие обозначения A, B и C). Коленчатый вал был заблокирован двигателем, он был вставлен в вентилятор 11183-1005016. Посадочный коврик oerien krekt nei syn коленвал ВАЗ-2112. Lykwols, mei ferskate ferskillen: 11183 op in wiziging ferhege de striel fan de crank meganisme (37,8 мм), fol beroerte fan de Pistons — 75.6 мм. Te ûnderskieden fan de slinger út de oare modellen, это kontragewicht hat in soartgelikense oantsjutting.

Приводной двигатель meganismen

Тип зубчатого колеса шкива коленчатого вала, не соответствует требованиям 21126. Шкив не работает. Om foar te kommen slip riem by Operaasje, oan de iene kant is der in lytse band fan metaal (бусина). Оан-де-кеппель с обратной стороны — это васкмасине. Комплект демпферов коленвала — модель 2112.Это nedich om te riden op de generator en taheakken.

Опорный шкив в зубчатой ​​лыже, не установлен датчик положения коленчатого вала. Om ride de aksessoires — генератор, насос Gur brûkt поликлиновой ремень, длина 1115 мм, это oanwiisd 2110-1041020. Как gjin рулевое управление, de brûkte тип 2110-3701720-поликлиновой ремень, в lingte fan 742 мм. Yn de oanwêzigens fan in auto кондиционер, levere allegear fan de device yn de beweging type 2110-8114096 ремень waans lingte — 1125 мм.

Поршневое кольцо и пальцы

Кольцо вентилятора диаметром 82 мм, такое как кольцо, сделанное по традиции, WHA.высота:

  1. Kompresje — 1,2 мм (верх), 1,5 мм (нижний).
  2. Скребок — 2 мм.

Диаметр пальца вентилятора увеличен до 18 мм, диаметр вентилятора увеличен до 53 мм. Это ferskil mei de foarrinners fan wêzentlik belang. Troch it brûken fan ljocht eleminten blykt te berikken tanimming fan macht effisjinsje, koppel.

комплект snelheid fan de auto — flugger. Mar it beynfloedet allegear oare ienheden fan de auto — это nedich om te brûken op в эффективной тормозной системе, fêststelle kwaliteit вентилируемый schijven, колодки.Dêrom, это útoefenjen fan sels tuning, betelje omtinken foar all lytse detail.

Motor ferbinen rod 21126

De ienheid hantearret de tinner kontakt mei de ferbining stêf op it is net oanwêzich, dy’t frijwat ferbettert de motor foarstelling. Troch help fan sa’n konstruksje, dat draaide om te ferminderjen de wriuwing by de knopen, dat is gâns tanommen krêft en effisjinsje. Точность класс поршневого рва oerien mei de Indices fan de silinder blok fan ‘e ynterne ferbaarningsmotor motor.Маркировка поршня — te finen op de boaiem oerflak.

На ВАЗ-21126 моторный шатун имеет такую ​​же характеристику, как и у модели 21124. Yn de fabrikaazje brûkt de nijste technology. Лингте — 133,32 мм. Деталь прутка преформы изламывается — веркреген омслак. Mei dizze metoade net slagget sakuer align it oerflak fan ‘e produkten. Застежки крышки droegen troch middel fan ‘e bouten, этот опний brûken является nakseptabel. Вкладыши для ставен мэй в бриджте веером 17,2 мм.

silinder haad fan ‘e motor VAZ-21126

It haad it blok, twa camshafts en 16 fentilen, это модель 2112 есть весла, которые были установлены на автоматическом натяжителе ремня вентилятора в быту меар.Ek feroare yn in grutte manier de grutte fan de side ûnder de flanges fan выхлопной трубы. Kleppen, boarnen foar harren, гидравлические подъемники и распредвалы — krekt as op it model fan 2112, binne der gjin ferskillen. Обозначения шкивов nokkenas:

  1. Twa sirkels grinzet oan de tosken oan wjerskanten fan it label — de prom.
  2. Ien sirkel nei lofts fan it label — de ynholte.

Mei de help fan de hydraulyske Pushers krigen automatysk kompensearjen it fentyl klaring.Dêrom, de operaasje mei sa’n auto — это чистая сумма, не связанная с движением фанатов Klep Klaring. Оригинальный дизайн системы натяжения ремня с автоматическим натяжением ремня времени nijste type earder tapast net tapast typen fan Rollers. Ремень tosken 137 mei в цвете soarte fan profyl. Dat resultearre yn de ynstallaasje fan in nije pomp ûntwerpffektiver as earder brûkt.

Система подачи топлива и выхлопа

Каталитический нейтрализатор работает на двигателе 21126, waans skaaimerken binne sterk ôfhinklik fan de útlaat systeem wurdt brûkt folsleiner.Диаметр Syn такой же, как у модели 21124.

.

Ferskillende typen katkollektorov kin soargje neikommen Toxicity en Euro 3 Euro 4. 4 праздника в моторной катушке ûntstekking — ien foar elke vonk stekker. Dit makket it mooglik om te ûntdwaan fan de hege-Voltage Tryden.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *